Incidental Mutation 'R2656:Bcl2l2'
ID252795
Institutional Source Beutler Lab
Gene Symbol Bcl2l2
Ensembl Gene ENSMUSG00000089682
Gene NameBCL2-like 2
SynonymsGtrosa41, bclw, Bcl-w, Gtrgal2
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54883377-54888234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54885432 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 47 (R47C)
Ref Sequence ENSEMBL: ENSMUSP00000133286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022806] [ENSMUST00000133397] [ENSMUST00000134077] [ENSMUST00000172844] [ENSMUST00000227108]
Predicted Effect probably benign
Transcript: ENSMUST00000022806
AA Change: R161C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022806
Gene: ENSMUSG00000089682
AA Change: R161C

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 172 188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131243
Predicted Effect probably benign
Transcript: ENSMUST00000133397
SMART Domains Protein: ENSMUSP00000116385
Gene: ENSMUSG00000089682

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134077
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172844
AA Change: R47C

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133286
Gene: ENSMUSG00000089682
AA Change: R47C

DomainStartEndE-ValueType
Pfam:Bcl-2 1 30 3.9e-7 PFAM
Blast:BCL 31 53 1e-7 BLAST
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227108
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mutants are male sterile with progressive loss of germ cells, Sertoli cells and Leydig cells beginning at puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Bcl2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03126:Bcl2l2 APN 14 54884767 missense probably damaging 1.00
R4042:Bcl2l2 UTSW 14 54884634 missense possibly damaging 0.82
R5278:Bcl2l2 UTSW 14 54884794 missense probably damaging 0.98
R6129:Bcl2l2 UTSW 14 54884745 missense possibly damaging 0.86
R6234:Bcl2l2 UTSW 14 54884788 missense probably benign 0.00
R7205:Bcl2l2 UTSW 14 54884601 missense probably benign
R7747:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7748:Bcl2l2 UTSW 14 54884379 start gained probably benign
R7779:Bcl2l2 UTSW 14 54884379 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CATCACGTAGACAGTGCAGAG -3'
(R):5'- GCATTCGCTATTGTTCCAGC -3'

Sequencing Primer
(F):5'- GTGCAGTAGAGCTTCGGC -3'
(R):5'- AGCTCTCCTGGCCCCTAG -3'
Posted On2014-12-04