Mutagenetix > Incidental Mutations

Incidental Mutation 'R2656:Zc3h7b'

252799

Institutional Source

Beutler Lab

Gene Symbol

Zc3h7b

Ensembl Gene

ENSMUSG00000022390

Gene Name

zinc finger CCCH type containing 7B

Synonyms

Scrg3

MMRRC Submission

040431-MU

Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R2656 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81745057-81796260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81780430 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 497 (Y497N)

Ref Sequence

ENSEMBL: ENSMUSP00000105181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000109554
AA Change: Y497N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: Y497N

Domain	Start	End	E-Value	Type
Pfam:TPR_11	34	113	2.3e-12	PFAM
Pfam:TPR_1	82	115	2.4e-6	PFAM
Pfam:TPR_8	82	115	8.2e-4	PFAM
Pfam:TPR_8	116	143	4.8e-3	PFAM
low complexity region	294	309	N/A	INTRINSIC
low complexity region	340	354	N/A	INTRINSIC
ZnF_C3H1	482	508	2.15e1	SMART
ZnF_C3H1	612	638	2.03e1	SMART
ZnF_C3H1	757	782	8.31e0	SMART
ZnF_C2H2	843	867	2.86e-1	SMART
ZnF_C3H1	889	914	7.81e-1	SMART
low complexity region	959	981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231108

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	A	G	5: 8,117,696	C655R	probably damaging	Het
Adgrf3	A	T	5: 30,196,438	V864D	possibly damaging	Het
Angptl3	A	G	4: 99,037,964	I444V	probably benign	Het
Atp8b2	C	T	3: 89,941,758	A1090T	probably benign	Het
BC005561	A	G	5: 104,519,315	I568V	probably benign	Het
Bcl2l2	C	T	14: 54,885,432	R47C	probably benign	Het
Ces2a	G	A	8: 104,736,134	M118I	probably benign	Het
Cyp4a29	T	G	4: 115,249,724	L193V	possibly damaging	Het
Dpp8	A	G	9: 65,080,804	Y877C	probably damaging	Het
Enpp6	C	T	8: 47,082,418	R33*	probably null	Het
Fsip2	G	A	2: 82,979,045	D1903N	possibly damaging	Het
Ggt1	T	A	10: 75,581,385	Y5*	probably null	Het
Gm14412	A	T	2: 177,315,200	C301S	unknown	Het
Gpatch2l	T	A	12: 86,288,810	D428E	probably damaging	Het
Grin2b	C	T	6: 135,733,429	G1040S	probably damaging	Het
Has2	T	C	15: 56,681,828	D126G	possibly damaging	Het
Itgam	T	G	7: 128,116,815	L1120R	probably null	Het
Kank4	T	C	4: 98,778,957	N418D	probably damaging	Het
Kcnk3	T	C	5: 30,622,671	V355A	possibly damaging	Het
Lonrf2	C	T	1: 38,815,960		probably null	Het
Lrp1b	A	T	2: 41,511,581	C240S	probably damaging	Het
Mapk8ip3	T	G	17: 24,912,807	E386A	probably damaging	Het
Mtmr14	A	G	6: 113,240,366	I80V	probably benign	Het
Nav2	A	C	7: 49,545,942	D961A	probably damaging	Het
Nmt2	A	G	2: 3,307,013	D107G	probably benign	Het
Nsd1	A	G	13: 55,246,868	K761E	probably damaging	Het
Ogdh	A	G	11: 6,348,678	T641A	probably benign	Het
Ogdhl	T	G	14: 32,332,826	F244V	possibly damaging	Het
Olfr1447	A	G	19: 12,901,666	I38T	probably benign	Het
Olfr1454	A	T	19: 13,063,984	H191L	probably benign	Het
Olfr639	G	A	7: 104,011,865	S279L	probably damaging	Het
Olfr699	T	A	7: 106,790,513	T163S	probably damaging	Het
Pfpl	T	C	19: 12,430,236	I617T	probably benign	Het
Ppfia2	T	G	10: 106,865,407		probably null	Het
Prickle1	T	C	15: 93,503,370	E411G	probably benign	Het
Prpsap2	C	A	11: 61,730,225	M343I	probably benign	Het
Prpsap2	A	G	11: 61,752,891	V72A	probably benign	Het
Ranbp17	A	T	11: 33,243,122	D977E	probably benign	Het
Rin1	T	C	19: 5,052,176	S238P	probably damaging	Het
Scap	C	T	9: 110,374,019	R254W	probably damaging	Het
Scn3a	T	C	2: 65,526,518	D194G	probably damaging	Het
Shisa7	T	C	7: 4,829,819	H481R	possibly damaging	Het
Slc6a6	T	C	6: 91,741,048	Y323H	probably damaging	Het
Tlr9	T	C	9: 106,223,941	S144P	probably benign	Het
Tmem69	T	A	4: 116,553,590	K61M	probably damaging	Het
Ttc21a	A	G	9: 119,941,265	D134G	probably damaging	Het
Ttn	A	G	2: 76,894,270		probably benign	Het
Vwf	A	G	6: 125,555,361	T26A	probably benign	Het
Zbtb16	A	T	9: 48,832,688	I108N	probably damaging	Het
Zfp652	A	G	11: 95,749,329	S27G	probably damaging	Het
Zfp808	A	G	13: 62,172,852	T632A	possibly damaging	Het
Znhit6	T	C	3: 145,578,169		probably null	Het

Other mutations in Zc3h7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01726:Zc3h7b	APN	15	81771799	missense	possibly damaging	0.95
IGL01955:Zc3h7b	APN	15	81792004	missense	probably benign	0.10
IGL02526:Zc3h7b	APN	15	81793137	missense	probably benign	0.10
IGL02582:Zc3h7b	APN	15	81769140	missense	probably benign	0.05
IGL02736:Zc3h7b	APN	15	81791974	missense	probably benign	0.02
F6893:Zc3h7b	UTSW	15	81778671	missense	possibly damaging	0.94
R0212:Zc3h7b	UTSW	15	81776328	missense	probably benign	0.00
R0242:Zc3h7b	UTSW	15	81768830	splice site	probably benign
R0471:Zc3h7b	UTSW	15	81781968	missense	probably damaging	1.00
R0590:Zc3h7b	UTSW	15	81776998	missense	possibly damaging	0.74
R1530:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1563:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1565:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1566:Zc3h7b	UTSW	15	81768834	missense	possibly damaging	0.91
R1670:Zc3h7b	UTSW	15	81777067	missense	probably benign
R1712:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1727:Zc3h7b	UTSW	15	81768029	missense	probably damaging	1.00
R2069:Zc3h7b	UTSW	15	81792328	missense	probably damaging	0.98
R2375:Zc3h7b	UTSW	15	81792502	missense	probably benign	0.17
R4660:Zc3h7b	UTSW	15	81792250	missense	probably benign	0.07
R4764:Zc3h7b	UTSW	15	81769183	critical splice donor site	probably null
R4815:Zc3h7b	UTSW	15	81793663	missense	probably damaging	1.00
R4999:Zc3h7b	UTSW	15	81779133	missense	probably damaging	1.00
R5086:Zc3h7b	UTSW	15	81793174	missense	probably damaging	0.96
R5169:Zc3h7b	UTSW	15	81773314	missense	probably benign	0.01
R5395:Zc3h7b	UTSW	15	81772501	missense	possibly damaging	0.50
R5407:Zc3h7b	UTSW	15	81785891	missense	probably damaging	0.99
R5587:Zc3h7b	UTSW	15	81771858	missense	possibly damaging	0.80
R5721:Zc3h7b	UTSW	15	81773298	missense	probably benign	0.02
R6001:Zc3h7b	UTSW	15	81792035	missense	possibly damaging	0.89
R6151:Zc3h7b	UTSW	15	81778710	critical splice donor site	probably null
R6248:Zc3h7b	UTSW	15	81783185	missense	probably damaging	1.00
R6397:Zc3h7b	UTSW	15	81792854	missense	probably benign	0.03
R6502:Zc3h7b	UTSW	15	81769051	missense	probably benign	0.01
R7248:Zc3h7b	UTSW	15	81771787	missense	possibly damaging	0.46
R7397:Zc3h7b	UTSW	15	81769153	missense	possibly damaging	0.50
R7450:Zc3h7b	UTSW	15	81783080	missense	probably benign
R7471:Zc3h7b	UTSW	15	81780481	missense	probably damaging	1.00
R7575:Zc3h7b	UTSW	15	81777885	nonsense	probably null
R7645:Zc3h7b	UTSW	15	81780602	missense	probably damaging	1.00
R7650:Zc3h7b	UTSW	15	81793650	missense	possibly damaging	0.81
R7881:Zc3h7b	UTSW	15	81780478	missense	probably damaging	1.00
R7964:Zc3h7b	UTSW	15	81780478	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGGGGCCTGGTAATTAG -3'
(R):5'- CATGGTGGTCTGATGAACGG -3'

Sequencing Primer
(F):5'- CCTGGTAATTAGGAAAAGGATCCATC -3'
(R):5'- CAGGCAGGTACCTCACAGAG -3'

Posted On

2014-12-04