Incidental Mutation 'R2656:Rin1'
ID252807
Institutional Source Beutler Lab
Gene Symbol Rin1
Ensembl Gene ENSMUSG00000024883
Gene NameRas and Rab interactor 1
Synonyms
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2656 (G1)
Quality Score213
Status Not validated
Chromosome19
Chromosomal Location5050481-5057071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5052176 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 238 (S238P)
Ref Sequence ENSEMBL: ENSMUSP00000153189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025818] [ENSMUST00000116567] [ENSMUST00000224178] [ENSMUST00000224288] [ENSMUST00000224363] [ENSMUST00000225427] [ENSMUST00000225799]
Predicted Effect probably damaging
Transcript: ENSMUST00000025818
AA Change: S249P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025818
Gene: ENSMUSG00000024883
AA Change: S249P

DomainStartEndE-ValueType
SH2 66 153 2.16e-5 SMART
low complexity region 241 264 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
low complexity region 307 341 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 432 454 N/A INTRINSIC
VPS9 478 596 2.29e-64 SMART
RA 613 694 1.14e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116567
SMART Domains Protein: ENSMUSP00000112266
Gene: ENSMUSG00000080268

DomainStartEndE-ValueType
low complexity region 29 59 N/A INTRINSIC
Pfam:Sds3 60 209 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224032
Predicted Effect probably benign
Transcript: ENSMUST00000224178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224254
Predicted Effect probably benign
Transcript: ENSMUST00000224288
Predicted Effect probably damaging
Transcript: ENSMUST00000224363
AA Change: S181P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225203
Predicted Effect probably damaging
Transcript: ENSMUST00000225427
AA Change: S238P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225799
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an enhanced conditioned response in cued conditioning protocols and avoidance learning tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Rin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rin1 APN 19 5051376 missense probably benign 0.43
IGL00504:Rin1 APN 19 5052410 missense probably benign 0.00
IGL01750:Rin1 APN 19 5052036 missense possibly damaging 0.74
IGL02828:Rin1 APN 19 5053090 missense possibly damaging 0.82
IGL02867:Rin1 APN 19 5053170 missense probably damaging 1.00
IGL02879:Rin1 APN 19 5051355 missense probably damaging 0.99
IGL03055:Rin1 UTSW 19 5053159 missense probably benign
R0193:Rin1 UTSW 19 5052652 missense probably damaging 0.96
R1174:Rin1 UTSW 19 5055203 missense probably benign 0.02
R1712:Rin1 UTSW 19 5055143 missense probably benign 0.00
R3930:Rin1 UTSW 19 5052974 missense probably benign 0.14
R4704:Rin1 UTSW 19 5054990 missense probably damaging 1.00
R5326:Rin1 UTSW 19 5052624 missense probably damaging 1.00
R6778:Rin1 UTSW 19 5054886 missense probably damaging 1.00
R7107:Rin1 UTSW 19 5050773 unclassified probably benign
R7391:Rin1 UTSW 19 5050860 start codon destroyed probably null 0.99
R7535:Rin1 UTSW 19 5052536 missense probably benign 0.01
R7818:Rin1 UTSW 19 5052191 missense probably benign 0.03
R8037:Rin1 UTSW 19 5051824
Predicted Primers PCR Primer
(F):5'- TCTGGAGCTCCTCACTCAAC -3'
(R):5'- TGTAGGGCTTCCTGAAGAGC -3'

Sequencing Primer
(F):5'- GAGCTCCTCACTCAACACCAAGG -3'
(R):5'- TGAAGAGCCCTCCTCCTCTGAG -3'
Posted On2014-12-04