Incidental Mutation 'R2656:Olfr1454'
ID252815
Institutional Source Beutler Lab
Gene Symbol Olfr1454
Ensembl Gene ENSMUSG00000094986
Gene Nameolfactory receptor 1454
SynonymsMOR202-14, GA_x6K02T2RE5P-3390804-3391727
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13060610-13067157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13063984 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 191 (H191L)
Ref Sequence ENSEMBL: ENSMUSP00000148859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073732] [ENSMUST00000213806] [ENSMUST00000214695] [ENSMUST00000217568]
Predicted Effect probably benign
Transcript: ENSMUST00000073732
AA Change: H191L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073409
Gene: ENSMUSG00000094986
AA Change: H191L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-50 PFAM
Pfam:7tm_1 39 288 2.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208608
Predicted Effect probably benign
Transcript: ENSMUST00000213806
AA Change: H191L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000214695
AA Change: H191L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000217568
AA Change: H191L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Olfr1454
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Olfr1454 APN 19 13064149 missense probably damaging 1.00
IGL02942:Olfr1454 APN 19 13064188 missense probably benign 0.45
IGL03331:Olfr1454 APN 19 13063867 missense probably damaging 1.00
R0551:Olfr1454 UTSW 19 13064294 missense probably benign 0.01
R0738:Olfr1454 UTSW 19 13063738 missense probably damaging 1.00
R1532:Olfr1454 UTSW 19 13064275 missense probably damaging 1.00
R2072:Olfr1454 UTSW 19 13063680 missense probably benign 0.00
R2092:Olfr1454 UTSW 19 13063802 nonsense probably null
R2850:Olfr1454 UTSW 19 13063570 missense probably damaging 1.00
R4212:Olfr1454 UTSW 19 13063759 missense probably damaging 0.98
R5303:Olfr1454 UTSW 19 13063775 nonsense probably null
R6362:Olfr1454 UTSW 19 13063345 start gained probably benign
R6928:Olfr1454 UTSW 19 13063984 missense probably benign 0.05
R7183:Olfr1454 UTSW 19 13064316 missense probably benign 0.00
R7701:Olfr1454 UTSW 19 13064081 missense probably damaging 1.00
R7741:Olfr1454 UTSW 19 13064059 missense probably damaging 0.98
R8057:Olfr1454 UTSW 19 13063274 start gained probably benign
Z1176:Olfr1454 UTSW 19 13063646 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CGTTATGTAGCAGTATGTAAGCCC -3'
(R):5'- AGCTGGGCTGCAAGTACATG -3'

Sequencing Primer
(F):5'- GCAGTATGTAAGCCCCTACATTATGC -3'
(R):5'- CTGGGCTGCAAGTACATGAATATG -3'
Posted On2014-12-04