Incidental Mutation 'R2860:Cap1'
ID252818
Institutional Source Beutler Lab
Gene Symbol Cap1
Ensembl Gene ENSMUSG00000028656
Gene NameCAP, adenylate cyclase-associated protein 1 (yeast)
Synonyms
MMRRC Submission 040450-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R2860 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location122859047-122886056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122864725 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 221 (S221T)
Ref Sequence ENSEMBL: ENSMUSP00000101864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069533] [ENSMUST00000106255] [ENSMUST00000106257] [ENSMUST00000128485]
Predicted Effect probably benign
Transcript: ENSMUST00000069533
AA Change: S221T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068260
Gene: ENSMUSG00000028656
AA Change: S221T

DomainStartEndE-ValueType
Pfam:CAP_N 4 304 1e-129 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106255
AA Change: S221T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101862
Gene: ENSMUSG00000028656
AA Change: S221T

DomainStartEndE-ValueType
Pfam:CAP_N 5 294 4.2e-116 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106257
AA Change: S221T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101864
Gene: ENSMUSG00000028656
AA Change: S221T

DomainStartEndE-ValueType
Pfam:CAP_N 4 304 1e-129 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128485
SMART Domains Protein: ENSMUSP00000114847
Gene: ENSMUSG00000028656

DomainStartEndE-ValueType
Pfam:CAP_N 4 164 2.3e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150919
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: The product of this gene plays a role in regulating actin dynamics by binding actin monomers and promoting the turnover of actin filaments. Reduced expression of this gene causes a reduction in actin filament turnover rates, causing multiple defects, including an increase in cell size, stress-fiber alterations, and defects in endocytosis and cell motility. A pseudogene of this gene is found on chromosome 14. Alternative splicing results in multiple transcript variants, but does not affect the protein. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C2 T C 17: 34,863,878 T471A possibly damaging Het
C4b T A 17: 34,734,758 S959C probably damaging Het
Capn2 A T 1: 182,472,920 probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kcnn1 T C 8: 70,846,535 K487R probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Pum3 A T 19: 27,420,125 probably benign Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tex14 T G 11: 87,474,417 D62E probably damaging Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Wiz G T 17: 32,361,706 T257K probably damaging Het
Xirp1 T C 9: 120,019,815 M1V probably null Het
Xirp1 A G 9: 120,018,378 S41P probably benign Het
Other mutations in Cap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Cap1 APN 4 122860187 missense probably damaging 0.99
IGL02163:Cap1 APN 4 122862416 missense probably benign 0.00
R0115:Cap1 UTSW 4 122863075 missense possibly damaging 0.94
R0119:Cap1 UTSW 4 122867699 missense probably damaging 1.00
R0481:Cap1 UTSW 4 122863075 missense possibly damaging 0.94
R0534:Cap1 UTSW 4 122862719 missense probably benign 0.07
R0602:Cap1 UTSW 4 122872409 missense probably damaging 1.00
R0846:Cap1 UTSW 4 122862899 critical splice donor site probably null
R1311:Cap1 UTSW 4 122865214 missense possibly damaging 0.89
R2027:Cap1 UTSW 4 122862893 unclassified probably benign
R2446:Cap1 UTSW 4 122864608 missense probably benign 0.22
R2861:Cap1 UTSW 4 122864725 missense probably benign 0.01
R2862:Cap1 UTSW 4 122864725 missense probably benign 0.01
R3690:Cap1 UTSW 4 122864626 missense probably damaging 0.98
R3691:Cap1 UTSW 4 122864626 missense probably damaging 0.98
R4089:Cap1 UTSW 4 122862409 missense probably benign 0.05
R4362:Cap1 UTSW 4 122862987 missense probably benign 0.00
R5511:Cap1 UTSW 4 122862790 unclassified probably benign
R6252:Cap1 UTSW 4 122872400 missense probably benign 0.37
R7001:Cap1 UTSW 4 122864615 missense probably benign 0.12
R7709:Cap1 UTSW 4 122862674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTTAACAACTGCCCATGC -3'
(R):5'- AGGAGACTTAAATCACCAAGGC -3'

Sequencing Primer
(F):5'- TGCCAAAATACTCACCATGTGTG -3'
(R):5'- GATGGTCCAGCATTTAAGAGCTC -3'
Posted On2014-12-04