Incidental Mutation 'R2860:Tex14'
ID252845
Institutional Source Beutler Lab
Gene Symbol Tex14
Ensembl Gene ENSMUSG00000010342
Gene Nametestis expressed gene 14
Synonyms
MMRRC Submission 040450-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2860 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87405065-87555823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87474417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 62 (D62E)
Ref Sequence ENSEMBL: ENSMUSP00000118114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060835] [ENSMUST00000156483]
Predicted Effect probably damaging
Transcript: ENSMUST00000060835
AA Change: D50E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342
AA Change: D50E

DomainStartEndE-ValueType
ANK 22 51 7.99e2 SMART
ANK 55 84 6.36e-3 SMART
ANK 88 117 3.49e0 SMART
Pfam:Pkinase 251 504 3.5e-19 PFAM
Pfam:Pkinase_Tyr 254 503 8.1e-28 PFAM
coiled coil region 659 684 N/A INTRINSIC
coiled coil region 740 776 N/A INTRINSIC
low complexity region 1219 1236 N/A INTRINSIC
coiled coil region 1289 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156483
AA Change: D62E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118114
Gene: ENSMUSG00000010342
AA Change: D62E

DomainStartEndE-ValueType
ANK 34 63 7.99e2 SMART
ANK 67 96 6.36e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196353
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C2 T C 17: 34,863,878 T471A possibly damaging Het
C4b T A 17: 34,734,758 S959C probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Capn2 A T 1: 182,472,920 probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kcnn1 T C 8: 70,846,535 K487R probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Pum3 A T 19: 27,420,125 probably benign Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Wiz G T 17: 32,361,706 T257K probably damaging Het
Xirp1 T C 9: 120,019,815 M1V probably null Het
Xirp1 A G 9: 120,018,378 S41P probably benign Het
Other mutations in Tex14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tex14 APN 11 87535643 missense probably damaging 0.98
IGL00494:Tex14 APN 11 87555484 missense probably damaging 1.00
IGL01604:Tex14 APN 11 87509698 missense possibly damaging 0.63
IGL02690:Tex14 APN 11 87486274 missense probably benign 0.11
IGL02888:Tex14 APN 11 87527912 critical splice donor site probably null
IGL03073:Tex14 APN 11 87535609 missense probably damaging 0.99
IGL03109:Tex14 APN 11 87543365 missense probably damaging 1.00
IGL03047:Tex14 UTSW 11 87536704 missense probably damaging 1.00
R0141:Tex14 UTSW 11 87493031 splice site probably null
R0455:Tex14 UTSW 11 87514305 missense possibly damaging 0.93
R0624:Tex14 UTSW 11 87520699 missense probably benign 0.19
R0718:Tex14 UTSW 11 87499613 missense probably benign 0.20
R1077:Tex14 UTSW 11 87519745 splice site probably benign
R1118:Tex14 UTSW 11 87522517 missense probably benign 0.07
R1120:Tex14 UTSW 11 87538676 splice site probably benign
R1168:Tex14 UTSW 11 87536742 missense probably benign 0.11
R1190:Tex14 UTSW 11 87495108 intron probably null
R1470:Tex14 UTSW 11 87549529 splice site probably benign
R1563:Tex14 UTSW 11 87536808 missense probably damaging 0.99
R1607:Tex14 UTSW 11 87554928 missense probably damaging 1.00
R1696:Tex14 UTSW 11 87511545 missense possibly damaging 0.49
R1873:Tex14 UTSW 11 87499605 missense probably damaging 1.00
R1894:Tex14 UTSW 11 87474448 missense probably damaging 1.00
R1911:Tex14 UTSW 11 87495035 missense probably damaging 1.00
R1955:Tex14 UTSW 11 87509621 missense probably damaging 1.00
R1971:Tex14 UTSW 11 87511605 missense probably damaging 1.00
R1990:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1991:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1993:Tex14 UTSW 11 87536755 missense possibly damaging 0.57
R2106:Tex14 UTSW 11 87486250 missense possibly damaging 0.47
R2118:Tex14 UTSW 11 87519743 splice site probably benign
R2861:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R4016:Tex14 UTSW 11 87538623 unclassified probably null
R4089:Tex14 UTSW 11 87512203 missense probably damaging 1.00
R4158:Tex14 UTSW 11 87516769 missense probably benign 0.06
R4533:Tex14 UTSW 11 87536829 nonsense probably null
R4713:Tex14 UTSW 11 87536865 missense probably damaging 0.99
R4758:Tex14 UTSW 11 87514485 missense probably benign 0.00
R4880:Tex14 UTSW 11 87486295 missense possibly damaging 0.95
R4953:Tex14 UTSW 11 87536901 critical splice donor site probably null
R5092:Tex14 UTSW 11 87514842 missense probably benign 0.03
R5119:Tex14 UTSW 11 87433813 missense probably damaging 1.00
R5322:Tex14 UTSW 11 87511472 missense probably benign 0.04
R5470:Tex14 UTSW 11 87551604 missense probably damaging 0.99
R5607:Tex14 UTSW 11 87522578 missense probably benign 0.00
R5642:Tex14 UTSW 11 87514220 missense probably benign
R5643:Tex14 UTSW 11 87535626 missense probably damaging 1.00
R5786:Tex14 UTSW 11 87514295 missense probably damaging 0.97
R6478:Tex14 UTSW 11 87514373 missense probably benign
R6560:Tex14 UTSW 11 87497862 missense possibly damaging 0.95
R6661:Tex14 UTSW 11 87495016 missense probably damaging 1.00
R7037:Tex14 UTSW 11 87497915 missense probably damaging 1.00
R7156:Tex14 UTSW 11 87484719 missense probably damaging 0.99
R7465:Tex14 UTSW 11 87514430 missense possibly damaging 0.48
R7675:Tex14 UTSW 11 87509678 missense probably damaging 1.00
R7725:Tex14 UTSW 11 87495042 missense probably damaging 0.99
R7911:Tex14 UTSW 11 87533602 critical splice donor site probably null
R7992:Tex14 UTSW 11 87533602 critical splice donor site probably null
R8015:Tex14 UTSW 11 87509600 missense not run
RF018:Tex14 UTSW 11 87514746 missense probably benign 0.01
X0017:Tex14 UTSW 11 87535549 nonsense probably null
Z1176:Tex14 UTSW 11 87484807 missense not run
Z1176:Tex14 UTSW 11 87499593 missense not run
Z1177:Tex14 UTSW 11 87514155 missense not run
Predicted Primers PCR Primer
(F):5'- AATAACAGAAAAGATAGGGATTTCTCC -3'
(R):5'- AGAAATTGCATATAACCTTTTGGGA -3'

Sequencing Primer
(F):5'- GGACTGAGACCCTGTTTCAAAAGTC -3'
(R):5'- AGTGGCTGACATCTGCAATC -3'
Posted On2014-12-04