Incidental Mutation 'R0312:Bnc1'
ID25285
Institutional Source Beutler Lab
Gene Symbol Bnc1
Ensembl Gene ENSMUSG00000025105
Gene Namebasonuclin 1
Synonyms
MMRRC Submission 038522-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0312 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81966672-81992292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81977324 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 106 (R106H)
Ref Sequence ENSEMBL: ENSMUSP00000026096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026096
AA Change: R106H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026096
Gene: ENSMUSG00000025105
AA Change: R106H

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
ZnF_C2H2 354 377 1.43e-1 SMART
ZnF_C2H2 382 411 6.75e0 SMART
low complexity region 505 514 N/A INTRINSIC
low complexity region 541 554 N/A INTRINSIC
low complexity region 570 583 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
ZnF_C2H2 716 739 1.47e-3 SMART
ZnF_C2H2 744 771 5.62e0 SMART
low complexity region 855 876 N/A INTRINSIC
ZnF_C2H2 924 947 3.11e-2 SMART
ZnF_C2H2 952 979 8.09e-1 SMART
Meta Mutation Damage Score 0.3157 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. Alternative splicing of this gene results in multiple transcript variants, and multiple polyadenylation sites are indicated.[provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit thinning and delayed wound healing of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Abcb5 G T 12: 118,872,837 A1113D probably damaging Het
Adcy1 G T 11: 7,149,538 A673S probably benign Het
Apob T A 12: 8,009,034 H2505Q probably benign Het
Arhgap12 A G 18: 6,061,982 probably benign Het
Bcl9 C T 3: 97,209,411 E656K probably benign Het
Ccdc54 T C 16: 50,590,802 K34E possibly damaging Het
Cfap65 G A 1: 74,904,067 R1600W probably damaging Het
Csmd1 A T 8: 15,984,760 N2470K probably damaging Het
Cspp1 T C 1: 10,058,829 probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dhx40 G A 11: 86,771,949 T639I probably damaging Het
Dlg1 A G 16: 31,790,267 T227A probably benign Het
Dnah10 G A 5: 124,796,369 probably benign Het
Dnah3 T A 7: 120,045,659 K1133M probably damaging Het
Dock5 G C 14: 67,795,991 F976L possibly damaging Het
Evc C T 5: 37,328,541 C97Y possibly damaging Het
Fbxw7 T C 3: 84,967,569 probably benign Het
Fggy A C 4: 95,844,185 D112A probably damaging Het
Fpgs A G 2: 32,684,801 Y435H probably damaging Het
Fryl T A 5: 73,072,888 H1642L probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gda T A 19: 21,417,005 I237F probably damaging Het
Glt1d1 A G 5: 127,691,070 N247S probably damaging Het
Gm7647 T C 5: 94,962,980 S7P probably benign Het
Gpr31b C T 17: 13,051,611 V224I probably damaging Het
Hlf G A 11: 90,387,875 P121L possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ism1 G T 2: 139,678,672 M1I probably null Het
Kansl1l T C 1: 66,778,106 N365S probably null Het
Lama1 T C 17: 67,775,851 L1368P possibly damaging Het
Lima1 A G 15: 99,781,087 V491A possibly damaging Het
Lrch1 G T 14: 74,947,594 H23N possibly damaging Het
Lrp1b A G 2: 41,282,171 V1488A probably damaging Het
Lrp8 T C 4: 107,806,855 probably benign Het
Lrrc8e A G 8: 4,235,733 S653G probably benign Het
Mnat1 A G 12: 73,181,784 T141A possibly damaging Het
Mpeg1 C A 19: 12,462,403 N408K probably damaging Het
Myo7b T C 18: 32,014,337 E51G possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naa35 A G 13: 59,609,581 T257A probably benign Het
Obox5 T A 7: 15,757,560 H8Q probably damaging Het
Olfr196 A T 16: 59,167,839 F101L probably benign Het
Olfr350 A T 2: 36,850,360 I105L probably benign Het
Olfr638 T C 7: 104,004,025 V250A probably damaging Het
Phldb2 G T 16: 45,789,047 T732N probably damaging Het
Phyhip G T 14: 70,466,970 A210S possibly damaging Het
Pik3r4 A G 9: 105,686,210 D1262G probably damaging Het
Pip G A 6: 41,849,864 E48K possibly damaging Het
Plk4 C T 3: 40,813,547 L74F probably damaging Het
Prdm14 G A 1: 13,118,807 R438W probably damaging Het
Rab19 G A 6: 39,384,089 R57H probably benign Het
Rtl1 G T 12: 109,590,227 P1726Q probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skint6 A T 4: 112,809,100 V1176D possibly damaging Het
Slc12a1 A G 2: 125,226,028 I1012V probably damaging Het
Slc1a3 C T 15: 8,636,237 M509I probably benign Het
Spata18 G A 5: 73,666,881 G35E probably benign Het
Sspo C T 6: 48,455,401 P801L possibly damaging Het
Ugt2b37 C T 5: 87,250,665 G304D probably damaging Het
Vmn2r25 A T 6: 123,828,580 probably benign Het
Xrcc6 C A 15: 82,027,222 probably null Het
Other mutations in Bnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Bnc1 APN 7 81973707 nonsense probably null
IGL01293:Bnc1 APN 7 81974489 missense probably damaging 0.99
IGL02064:Bnc1 APN 7 81973503 missense probably benign 0.00
IGL02529:Bnc1 APN 7 81977368 missense probably damaging 0.99
IGL03087:Bnc1 APN 7 81974642 missense possibly damaging 0.86
R0088:Bnc1 UTSW 7 81978498 missense possibly damaging 0.52
R0631:Bnc1 UTSW 7 81974366 missense probably damaging 0.99
R0924:Bnc1 UTSW 7 81978408 splice site probably benign
R0928:Bnc1 UTSW 7 81973502 missense probably benign
R1967:Bnc1 UTSW 7 81973636 missense probably benign 0.03
R2243:Bnc1 UTSW 7 81974073 missense possibly damaging 0.59
R2404:Bnc1 UTSW 7 81968715 missense probably benign 0.08
R4079:Bnc1 UTSW 7 81973760 missense probably damaging 0.99
R4416:Bnc1 UTSW 7 81968960 missense probably benign
R5038:Bnc1 UTSW 7 81968714 missense probably damaging 1.00
R5055:Bnc1 UTSW 7 81974415 missense probably damaging 0.99
R7083:Bnc1 UTSW 7 81973310 missense probably damaging 1.00
R7117:Bnc1 UTSW 7 81973361 missense possibly damaging 0.92
R7151:Bnc1 UTSW 7 81973307 missense possibly damaging 0.71
R7386:Bnc1 UTSW 7 81974492 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCACGTAAGAGCCTTTTCTCGTCC -3'
(R):5'- AGCTTTCCCAAACGTCTCGCAC -3'

Sequencing Primer
(F):5'- TGCTCAAGAGTTCACATAGTGCC -3'
(R):5'- GCACTTGATTTTCAGCTCTGAGTAAG -3'
Posted On2013-04-16