Incidental Mutation 'R2860:C2'
ID252865
Institutional Source Beutler Lab
Gene Symbol C2
Ensembl Gene ENSMUSG00000024371
Gene Namecomplement component 2 (within H-2S)
Synonymsclassical-complement pathway C3/C5 convertase
MMRRC Submission 040450-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R2860 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34862604-34898265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34863878 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 471 (T471A)
Ref Sequence ENSEMBL: ENSMUSP00000123536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000154526] [ENSMUST00000176203]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000025230
AA Change: T608A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371
AA Change: T608A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect probably benign
Transcript: ENSMUST00000128767
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129891
AA Change: T224A
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511
AA Change: T224A

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000134300
AA Change: T111A
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371
AA Change: T111A

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000146299
AA Change: T455A
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: T455A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148431
AA Change: T331A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371
AA Change: T331A

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152417
AA Change: T471A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371
AA Change: T471A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154526
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176203
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Meta Mutation Damage Score 0.1854 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes component C2 of the classical pathway of the complement system. The encoded protein undergoes proteolytic processing mediated by component C1 resulting in C2a and C2b fragments. C2a fragment, in turn, selectively cleaves components C3 and C5 of the complement system. Mice lacking the encoded protein are found to be more susceptible to bacterial infections. Mutations in the human homolog of this gene are associated with disorders such as systemic lupus erythematosus, Henoch-Schonlein purpura, or polymyositis. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C4b T A 17: 34,734,758 S959C probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Capn2 A T 1: 182,472,920 probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kcnn1 T C 8: 70,846,535 K487R probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Pum3 A T 19: 27,420,125 probably benign Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tex14 T G 11: 87,474,417 D62E probably damaging Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Wiz G T 17: 32,361,706 T257K probably damaging Het
Xirp1 T C 9: 120,019,815 M1V probably null Het
Xirp1 A G 9: 120,018,378 S41P probably benign Het
Other mutations in C2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:C2 APN 17 34866563 missense probably damaging 1.00
IGL02249:C2 APN 17 34864508 unclassified probably benign
IGL02568:C2 APN 17 34864349 missense possibly damaging 0.50
IGL03013:C2 APN 17 34872459 missense probably damaging 0.98
R0142:C2 UTSW 17 34873528 missense possibly damaging 0.53
R0619:C2 UTSW 17 34872503 missense probably damaging 1.00
R1401:C2 UTSW 17 34872481 missense possibly damaging 0.71
R1639:C2 UTSW 17 34872403 missense probably benign 0.02
R1808:C2 UTSW 17 34864532 missense probably damaging 1.00
R2133:C2 UTSW 17 34879902 missense probably damaging 1.00
R2861:C2 UTSW 17 34863878 missense possibly damaging 0.94
R3882:C2 UTSW 17 34873489 missense probably benign 0.00
R4571:C2 UTSW 17 34863659 missense probably benign 0.00
R4622:C2 UTSW 17 34863674 missense probably damaging 0.99
R5611:C2 UTSW 17 34872384 missense probably damaging 0.99
R5767:C2 UTSW 17 34876456 missense possibly damaging 0.58
R6327:C2 UTSW 17 34864103 missense probably benign 0.41
R6448:C2 UTSW 17 34863359 missense possibly damaging 0.67
R6518:C2 UTSW 17 34864118 missense probably damaging 1.00
R6929:C2 UTSW 17 34864347 missense possibly damaging 0.68
R7324:C2 UTSW 17 34881688 missense probably benign 0.13
R7446:C2 UTSW 17 34876010 missense probably damaging 1.00
R7456:C2 UTSW 17 34864582 missense probably damaging 1.00
R7479:C2 UTSW 17 34863465 missense probably damaging 1.00
R7807:C2 UTSW 17 34876371 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGAAGTTCTGTCTCTGCCATTGG -3'
(R):5'- TGCTGATGACATTGCCTTGC -3'

Sequencing Primer
(F):5'- TGCCATTGGGGAGAAGTGG -3'
(R):5'- CCTTGCTGAAGCTATCTCGGAAAG -3'
Posted On2014-12-04