Incidental Mutation 'R2511:Ifnlr1'
ID252878
Institutional Source Beutler Lab
Gene Symbol Ifnlr1
Ensembl Gene ENSMUSG00000062157
Gene Nameinterferon lambda receptor 1
SynonymsIFNLR1, Il28ra, CRF2-12
MMRRC Submission 040417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2511 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135686287-135708181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 135705248 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 332 (D332Y)
Ref Sequence ENSEMBL: ENSMUSP00000074009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074408]
Predicted Effect probably damaging
Transcript: ENSMUST00000074408
AA Change: D332Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074009
Gene: ENSMUSG00000062157
AA Change: D332Y

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
FN3 24 108 7.75e0 SMART
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and normal with respect to viral infection, however antiviral response evoked by TLRs are significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
9330159F19Rik T A 10: 29,221,906 C100S probably damaging Het
Abcc8 C T 7: 46,150,780 R526H probably damaging Het
Acad10 G A 5: 121,631,567 P609S probably benign Het
Acod1 A T 14: 103,051,339 D95V probably damaging Het
Acsm5 A T 7: 119,530,454 I130F possibly damaging Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ankar A T 1: 72,658,694 I791K probably damaging Het
Ano10 A G 9: 122,258,945 V364A probably damaging Het
Arhgap9 T C 10: 127,328,985 probably null Het
Arsi G A 18: 60,916,594 C183Y probably damaging Het
Ascl2 T G 7: 142,968,216 E97A probably damaging Het
Asna1 A G 8: 85,019,766 V151A possibly damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bms1 C T 6: 118,391,153 probably null Het
Bysl T A 17: 47,604,335 T163S probably benign Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cc2d2a A T 5: 43,735,395 Q1433L probably damaging Het
Cchcr1 T C 17: 35,530,513 S809P probably benign Het
Ccz1 G T 5: 144,012,997 T70K probably damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cep164 A T 9: 45,775,249 L729Q probably damaging Het
Clcn6 A G 4: 148,017,494 probably null Het
Clcn7 T A 17: 25,155,446 V507E probably damaging Het
Ctso A C 3: 81,932,734 T24P probably damaging Het
Dis3l2 A T 1: 86,990,258 N543I probably benign Het
Dnah12 A T 14: 26,769,950 Y1114F possibly damaging Het
Emx1 A G 6: 85,204,051 D250G probably benign Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Fam149b A C 14: 20,378,456 N341T probably damaging Het
Fsip2 A G 2: 82,951,657 K62R probably damaging Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
Gbp3 A G 3: 142,570,582 R480G probably benign Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm9930 T C 10: 9,534,702 noncoding transcript Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Gzmg A T 14: 56,158,375 D42E probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Hs2st1 G A 3: 144,569,930 probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Irf1 T C 11: 53,773,791 V108A probably damaging Het
Jsrp1 C G 10: 80,812,306 S36T probably benign Het
Kcnq5 T A 1: 21,505,782 R233* probably null Het
Kif7 T C 7: 79,702,264 K917E probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Lifr A G 15: 7,166,916 T194A probably benign Het
Ltbp2 T C 12: 84,804,409 probably null Het
Man2c1 A G 9: 57,141,388 probably null Het
Met T C 6: 17,491,967 S243P probably damaging Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mre11a A C 9: 14,795,769 probably null Het
Mroh9 A G 1: 163,038,945 S710P probably benign Het
Mvk C A 5: 114,450,398 Y116* probably null Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncf1 T C 5: 134,225,698 D184G probably damaging Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1137 T C 2: 87,711,048 N286S probably damaging Het
Olfr1301 T A 2: 111,754,316 N22K probably benign Het
Olfr1449 T A 19: 12,935,173 M145K possibly damaging Het
Olfr690 A T 7: 105,329,610 I194N probably damaging Het
Olfr700 G T 7: 106,805,961 P167H probably damaging Het
Pcdh1 G A 18: 38,199,479 T296M possibly damaging Het
Pcdh15 A G 10: 74,645,996 D391G possibly damaging Het
Pcdha7 C A 18: 36,974,733 D270E probably damaging Het
Pgam1 C A 19: 41,915,876 S137R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plce1 T G 19: 38,760,054 I1729S probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Prkce T A 17: 86,625,326 I578N probably damaging Het
Prss58 A C 6: 40,897,800 S36A probably damaging Het
Ptprm T C 17: 66,693,778 H1128R probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rubcn T C 16: 32,847,254 N179S probably damaging Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Sh3bp5 G A 14: 31,411,629 T82M probably damaging Het
Shank2 A G 7: 144,411,577 Y974C probably damaging Het
Slc9c1 T C 16: 45,544,736 I144T possibly damaging Het
Slf2 T C 19: 44,941,606 I374T possibly damaging Het
Snx13 A G 12: 35,138,081 D786G probably benign Het
Spcs3 A G 8: 54,523,354 V151A possibly damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stac3 T C 10: 127,503,918 probably null Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgm5 T C 2: 121,076,948 E98G possibly damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tmem94 G A 11: 115,791,961 R608H probably damaging Het
Tnrc6a G A 7: 123,171,092 V702I probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim24 G A 6: 37,903,652 probably null Het
Ugt1a2 A G 1: 88,201,124 Y163C probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn2r50 T A 7: 10,047,713 E368D possibly damaging Het
Vmn2r59 T C 7: 42,043,766 N470S probably damaging Het
Vps45 T C 3: 96,041,445 T333A probably benign Het
Zbtb44 T A 9: 31,054,243 D316E probably damaging Het
Zdhhc1 C T 8: 105,483,558 V76M probably benign Het
Zfp235 T C 7: 24,142,124 F656S probably damaging Het
Other mutations in Ifnlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Ifnlr1 APN 4 135704285 missense probably benign 0.28
IGL01637:Ifnlr1 APN 4 135686545 missense possibly damaging 0.63
IGL02090:Ifnlr1 APN 4 135705267 missense probably benign 0.23
R0677:Ifnlr1 UTSW 4 135705634 missense possibly damaging 0.78
R0723:Ifnlr1 UTSW 4 135701213 splice site probably benign
R0762:Ifnlr1 UTSW 4 135701329 missense possibly damaging 0.90
R1169:Ifnlr1 UTSW 4 135705108 missense probably benign 0.00
R1303:Ifnlr1 UTSW 4 135704217 missense possibly damaging 0.67
R1819:Ifnlr1 UTSW 4 135686523 start gained probably benign
R1957:Ifnlr1 UTSW 4 135686570 missense probably damaging 1.00
R2041:Ifnlr1 UTSW 4 135705837 missense possibly damaging 0.51
R2509:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R2510:Ifnlr1 UTSW 4 135705248 missense probably damaging 1.00
R3020:Ifnlr1 UTSW 4 135705730 small deletion probably benign
R3944:Ifnlr1 UTSW 4 135701228 missense probably damaging 1.00
R4495:Ifnlr1 UTSW 4 135705768 missense probably damaging 0.98
R4804:Ifnlr1 UTSW 4 135705336 missense possibly damaging 0.50
R4938:Ifnlr1 UTSW 4 135705282 missense probably benign 0.35
R5070:Ifnlr1 UTSW 4 135704198 missense probably benign 0.00
R5073:Ifnlr1 UTSW 4 135705146 missense probably benign 0.06
R5493:Ifnlr1 UTSW 4 135705566 missense probably benign 0.25
R5913:Ifnlr1 UTSW 4 135705269 missense probably damaging 1.00
R5913:Ifnlr1 UTSW 4 135705270 missense probably damaging 1.00
R5959:Ifnlr1 UTSW 4 135705341 missense possibly damaging 0.94
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6032:Ifnlr1 UTSW 4 135705626 missense probably benign 0.03
R6136:Ifnlr1 UTSW 4 135703797 missense possibly damaging 0.92
R7018:Ifnlr1 UTSW 4 135703824 missense possibly damaging 0.77
R7651:Ifnlr1 UTSW 4 135690608 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GATACCCAGTGGCAACCTTTC -3'
(R):5'- TGGAAGACCCAACTTCATCC -3'

Sequencing Primer
(F):5'- AACCTTTCAGCCCAGTGG -3'
(R):5'- GACCCAACTTCATCCTTATATGAGG -3'
Posted On2014-12-04