Incidental Mutation 'R2862:Nmnat2'
ID 252883
Institutional Source Beutler Lab
Gene Symbol Nmnat2
Ensembl Gene ENSMUSG00000042751
Gene Name nicotinamide nucleotide adenylyltransferase 2
Synonyms PNAT1, D030041I09Rik
MMRRC Submission 040452-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2862 (G1)
Quality Score 207
Status Not validated
Chromosome 1
Chromosomal Location 152954993-153119261 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 153112425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 267 (V267I)
Ref Sequence ENSEMBL: ENSMUSP00000140585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043313] [ENSMUST00000186368]
AlphaFold Q8BNJ3
Predicted Effect probably benign
Transcript: ENSMUST00000043313
AA Change: V267I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041110
Gene: ENSMUSG00000042751
AA Change: V267I

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 276 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186368
AA Change: V267I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140585
Gene: ENSMUSG00000042751
AA Change: V267I

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 275 2e-32 PFAM
Meta Mutation Damage Score 0.1023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family, members of which catalyze an essential step in NAD (NADP) biosynthetic pathway. Unlike the other human family member, which is localized to the nucleus, and is ubiquitously expressed; this enzyme is cytoplasmic, and is predominantly expressed in the brain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap or transposon inserted allele exhibit perinatal lethality, distended bladders, atelectasis and loss of axon integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,485,911 probably benign Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ahi1 T A 10: 20,981,408 V634E probably damaging Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Aqr A T 2: 114,136,917 V539D probably damaging Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cdca2 T C 14: 67,698,090 E392G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col22a1 A G 15: 71,815,943 probably null Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Dnah1 C T 14: 31,284,762 G2199S probably benign Het
Dnhd1 A G 7: 105,712,559 E3608G probably benign Het
Ears2 A T 7: 122,062,940 L95Q probably damaging Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Gata5 C T 2: 180,334,336 G12S possibly damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Grap2 A T 15: 80,647,964 Q260L probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama2 G A 10: 27,422,612 Q163* probably null Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lamp5 A T 2: 136,058,946 H22L probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mrps18b G A 17: 35,910,854 S101L probably benign Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Noc2l A G 4: 156,237,450 D102G probably benign Het
Ntn1 T C 11: 68,385,864 E86G probably benign Het
Olfr1214 A T 2: 88,987,320 I294K probably benign Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr664 A G 7: 104,734,218 F49L probably benign Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Pate3 T A 9: 35,648,119 M1L possibly damaging Het
Pex2 A G 3: 5,561,180 Y190H probably damaging Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Rreb1 G C 13: 37,932,453 A1263P probably benign Het
Rxfp1 A G 3: 79,682,471 V121A possibly damaging Het
Slc35e4 A T 11: 3,912,796 V131D probably damaging Het
Smyd4 T A 11: 75,390,136 M145K probably benign Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Srgap3 A T 6: 112,722,972 F1015Y probably damaging Het
Synj1 T C 16: 90,969,329 Y567C probably damaging Het
Tbc1d8 G A 1: 39,402,696 Q272* probably null Het
Tinf2 T C 14: 55,680,631 D127G probably damaging Het
Ube2v1 G A 2: 167,617,965 P39L probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Zc3h6 A G 2: 129,015,460 H633R probably benign Het
Other mutations in Nmnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Nmnat2 APN 1 153094117 splice site probably null
IGL01447:Nmnat2 APN 1 153112443 missense possibly damaging 0.50
IGL01686:Nmnat2 APN 1 153076997 splice site probably benign
IGL01916:Nmnat2 APN 1 153094046 missense probably damaging 0.99
R0309:Nmnat2 UTSW 1 153077001 splice site probably benign
R1245:Nmnat2 UTSW 1 153112203 missense probably benign 0.12
R1475:Nmnat2 UTSW 1 153074695 missense probably damaging 1.00
R1780:Nmnat2 UTSW 1 153112440 nonsense probably null
R2860:Nmnat2 UTSW 1 153112425 missense probably benign
R2861:Nmnat2 UTSW 1 153112425 missense probably benign
R2939:Nmnat2 UTSW 1 153074728 missense probably damaging 1.00
R5590:Nmnat2 UTSW 1 153094061 missense probably damaging 1.00
R6056:Nmnat2 UTSW 1 153074734 nonsense probably null
R6267:Nmnat2 UTSW 1 153076971 missense probably damaging 1.00
R9287:Nmnat2 UTSW 1 153086392 missense probably damaging 0.98
R9334:Nmnat2 UTSW 1 153073839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGTGAGTCCTCCATCCC -3'
(R):5'- GTGTCCACTTGAATCTAAGAGTCG -3'

Sequencing Primer
(F):5'- CCTGCTGGTACACCTCTGAGATAC -3'
(R):5'- GGTCTCCTTATCTGAAACTTGAAGC -3'
Posted On 2014-12-04