Incidental Mutation 'R2511:Cc2d2a'
ID 252886
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 040417-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R2511 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43892737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1433 (Q1433L)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: Q1433L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: Q1433L

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125866
AA Change: Q1372L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: Q1372L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,097,902 (GRCm39) C100S probably damaging Het
Abcc8 C T 7: 45,800,204 (GRCm39) R526H probably damaging Het
Acad10 G A 5: 121,769,630 (GRCm39) P609S probably benign Het
Acod1 A T 14: 103,288,775 (GRCm39) D95V probably damaging Het
Acsm5 A T 7: 119,129,677 (GRCm39) I130F possibly damaging Het
Ago4 A T 4: 126,410,864 (GRCm39) D208E probably damaging Het
Agrn A T 4: 156,250,881 (GRCm39) probably null Het
Ankar A T 1: 72,697,853 (GRCm39) I791K probably damaging Het
Ano10 A G 9: 122,088,011 (GRCm39) V364A probably damaging Het
Arhgap9 T C 10: 127,164,854 (GRCm39) probably null Het
Arsi G A 18: 61,049,666 (GRCm39) C183Y probably damaging Het
Ascl2 T G 7: 142,521,953 (GRCm39) E97A probably damaging Het
Bcl2a1a C T 9: 88,839,506 (GRCm39) R135W probably damaging Het
Bms1 C T 6: 118,368,114 (GRCm39) probably null Het
Bysl T A 17: 47,915,260 (GRCm39) T163S probably benign Het
Card10 A G 15: 78,664,473 (GRCm39) I821T probably benign Het
Cchcr1 T C 17: 35,841,410 (GRCm39) S809P probably benign Het
Ccz1 G T 5: 143,949,815 (GRCm39) T70K probably damaging Het
Cdc25c G C 18: 34,871,292 (GRCm39) L275V probably damaging Het
Cep164 A T 9: 45,686,547 (GRCm39) L729Q probably damaging Het
Clcn6 A G 4: 148,101,951 (GRCm39) probably null Het
Clcn7 T A 17: 25,374,420 (GRCm39) V507E probably damaging Het
Cracdl T C 1: 37,664,381 (GRCm39) M506V probably benign Het
Ctso A C 3: 81,840,041 (GRCm39) T24P probably damaging Het
Dis3l2 A T 1: 86,917,980 (GRCm39) N543I probably benign Het
Dnah12 A T 14: 26,491,907 (GRCm39) Y1114F possibly damaging Het
Emx1 A G 6: 85,181,033 (GRCm39) D250G probably benign Het
Epha4 G A 1: 77,488,339 (GRCm39) A47V possibly damaging Het
Fam149b A C 14: 20,428,524 (GRCm39) N341T probably damaging Het
Fsip2 A G 2: 82,782,001 (GRCm39) K62R probably damaging Het
Fsip2 T C 2: 82,816,782 (GRCm39) S4172P probably benign Het
Gbp3 A G 3: 142,276,343 (GRCm39) R480G probably benign Het
Get3 A G 8: 85,746,395 (GRCm39) V151A possibly damaging Het
Gja8 T G 3: 96,827,033 (GRCm39) T210P probably damaging Het
Gm5431 T A 11: 48,779,536 (GRCm39) N740I probably benign Het
Gm9930 T C 10: 9,410,446 (GRCm39) noncoding transcript Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Gzmg A T 14: 56,395,832 (GRCm39) D42E probably benign Het
Hoxd12 G A 2: 74,505,815 (GRCm39) A129T possibly damaging Het
Hs2st1 G A 3: 144,275,691 (GRCm39) probably benign Het
Ifnlr1 G T 4: 135,432,559 (GRCm39) D332Y probably damaging Het
Igsf10 T C 3: 59,239,287 (GRCm39) D298G probably damaging Het
Irf1 T C 11: 53,664,617 (GRCm39) V108A probably damaging Het
Jsrp1 C G 10: 80,648,140 (GRCm39) S36T probably benign Het
Kcnq5 T A 1: 21,576,006 (GRCm39) R233* probably null Het
Kif7 T C 7: 79,352,012 (GRCm39) K917E probably damaging Het
Krt7 A C 15: 101,310,538 (GRCm39) I62L probably benign Het
Lifr A G 15: 7,196,397 (GRCm39) T194A probably benign Het
Ltbp2 T C 12: 84,851,183 (GRCm39) probably null Het
Maco1 A G 4: 134,531,699 (GRCm39) S657P probably damaging Het
Man2c1 A G 9: 57,048,672 (GRCm39) probably null Het
Met T C 6: 17,491,966 (GRCm39) S243P probably damaging Het
Mllt10 C A 2: 18,069,935 (GRCm39) D30E possibly damaging Het
Mre11a A C 9: 14,707,065 (GRCm39) probably null Het
Mroh9 A G 1: 162,866,514 (GRCm39) S710P probably benign Het
Mvk C A 5: 114,588,459 (GRCm39) Y116* probably null Het
Myh1 A G 11: 67,096,423 (GRCm39) I301V probably benign Het
Ncf1 T C 5: 134,254,552 (GRCm39) D184G probably damaging Het
Nxpe4 T C 9: 48,304,533 (GRCm39) F207L probably damaging Het
Or2ag18 G T 7: 106,405,168 (GRCm39) P167H probably damaging Het
Or2y1b T G 11: 49,209,048 (GRCm39) L225R probably damaging Het
Or4k51 T A 2: 111,584,661 (GRCm39) N22K probably benign Het
Or52b1 A T 7: 104,978,817 (GRCm39) I194N probably damaging Het
Or5b24 T A 19: 12,912,537 (GRCm39) M145K possibly damaging Het
Or5w14 T C 2: 87,541,392 (GRCm39) N286S probably damaging Het
Pcdh1 G A 18: 38,332,532 (GRCm39) T296M possibly damaging Het
Pcdh15 A G 10: 74,481,828 (GRCm39) D391G possibly damaging Het
Pcdha7 C A 18: 37,107,786 (GRCm39) D270E probably damaging Het
Pgam1 C A 19: 41,904,315 (GRCm39) S137R probably damaging Het
Pitpnm2 T C 5: 124,274,389 (GRCm39) E240G probably damaging Het
Plce1 T G 19: 38,748,498 (GRCm39) I1729S probably damaging Het
Plppr4 G T 3: 117,125,355 (GRCm39) N161K probably damaging Het
Pramel27 G A 4: 143,578,561 (GRCm39) V274I probably benign Het
Prkce T A 17: 86,932,754 (GRCm39) I578N probably damaging Het
Prss58 A C 6: 40,874,734 (GRCm39) S36A probably damaging Het
Ptprm T C 17: 67,000,773 (GRCm39) H1128R probably damaging Het
Rgs9 T C 11: 109,159,798 (GRCm39) Y178C probably benign Het
Rubcn T C 16: 32,667,624 (GRCm39) N179S probably damaging Het
Sh3bp1 C T 15: 78,795,706 (GRCm39) P612S probably damaging Het
Sh3bp5 G A 14: 31,133,586 (GRCm39) T82M probably damaging Het
Shank2 A G 7: 143,965,314 (GRCm39) Y974C probably damaging Het
Slc9c1 T C 16: 45,365,099 (GRCm39) I144T possibly damaging Het
Slf2 T C 19: 44,930,045 (GRCm39) I374T possibly damaging Het
Snx13 A G 12: 35,188,080 (GRCm39) D786G probably benign Het
Spcs3 A G 8: 54,976,389 (GRCm39) V151A possibly damaging Het
Sstr2 A T 11: 113,515,749 (GRCm39) I223F probably damaging Het
Stac3 T C 10: 127,339,787 (GRCm39) probably null Het
Tas1r2 A G 4: 139,387,162 (GRCm39) N207S probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Tgm5 T C 2: 120,907,429 (GRCm39) E98G possibly damaging Het
Tktl2 A G 8: 66,965,504 (GRCm39) E354G probably benign Het
Tmem94 G A 11: 115,682,787 (GRCm39) R608H probably damaging Het
Tnrc6a G A 7: 122,770,315 (GRCm39) V702I probably damaging Het
Trappc10 A G 10: 78,047,357 (GRCm39) S380P possibly damaging Het
Trim24 G A 6: 37,880,587 (GRCm39) probably null Het
Ugt1a2 A G 1: 88,128,846 (GRCm39) Y163C probably damaging Het
Vmn1r215 A G 13: 23,260,343 (GRCm39) I128V probably benign Het
Vmn2r50 T A 7: 9,781,640 (GRCm39) E368D possibly damaging Het
Vmn2r59 T C 7: 41,693,190 (GRCm39) N470S probably damaging Het
Vps45 T C 3: 95,948,757 (GRCm39) T333A probably benign Het
Zbtb44 T A 9: 30,965,539 (GRCm39) D316E probably damaging Het
Zdhhc1 C T 8: 106,210,190 (GRCm39) V76M probably benign Het
Zfp235 T C 7: 23,841,549 (GRCm39) F656S probably damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0193:Cc2d2a UTSW 5 43,893,460 (GRCm39) missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43,894,854 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3147:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43,887,317 (GRCm39) missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43,826,015 (GRCm39) missense probably benign
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43,838,673 (GRCm39) missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43,869,781 (GRCm39) missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACACAGGTAAAACATGATCG -3'
(R):5'- TCTGTACTCTTCTGAAGGTCAAGTAAC -3'

Sequencing Primer
(F):5'- CACACAGGTAAAACATGATCGTTTTG -3'
(R):5'- AAGTGGATACCTCTACCAATTCTGC -3'
Posted On 2014-12-04