Mutagenetix > Incidental Mutations

Incidental Mutation 'R2862:Aqr'

252895

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

040452-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114136917 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 539 (V539D)

Ref Sequence

ENSEMBL: ENSMUSP00000099602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: V539D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: V539D

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102543
AA Change: V539D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: V539D

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126701

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	G	A	5: 31,485,911		probably benign	Het
Abca13	A	G	11: 9,309,057	S2928G	probably damaging	Het
Abcd1	T	A	X: 73,737,458	L713H	probably damaging	Het
Actg1	T	C	11: 120,346,801	I52V	probably benign	Het
Ahi1	T	A	10: 20,981,408	V634E	probably damaging	Het
Ang	G	T	14: 51,101,818	D139Y	probably damaging	Het
Apoe	T	C	7: 19,697,554	Y46C	probably damaging	Het
Btg3	A	G	16: 78,364,980	V114A	probably damaging	Het
Cap1	A	T	4: 122,864,725	S221T	probably benign	Het
Cdca2	T	C	14: 67,698,090	E392G	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col22a1	A	G	15: 71,815,943		probably null	Het
Cyp2c38	G	A	19: 39,460,694	R72W	probably benign	Het
Dnah1	C	T	14: 31,284,762	G2199S	probably benign	Het
Dnhd1	A	G	7: 105,712,559	E3608G	probably benign	Het
Ears2	A	T	7: 122,062,940	L95Q	probably damaging	Het
F5	A	T	1: 164,184,964	K482N	probably damaging	Het
Gata5	C	T	2: 180,334,336	G12S	possibly damaging	Het
Gm11938	C	A	11: 99,603,146	R41L	probably damaging	Het
Grap2	A	T	15: 80,647,964	Q260L	probably damaging	Het
Greb1	A	G	12: 16,711,745	S545P	probably benign	Het
Iglc1	T	C	16: 19,061,910		probably benign	Het
Il18r1	T	C	1: 40,498,557	V494A	possibly damaging	Het
Kdf1	G	A	4: 133,528,541	E190K	probably damaging	Het
Lama2	G	A	10: 27,422,612	Q163*	probably null	Het
Lama3	G	T	18: 12,453,750	L723F	probably damaging	Het
Lamp5	A	T	2: 136,058,946	H22L	probably benign	Het
Maged1	G	A	X: 94,538,924	P366S	probably damaging	Het
Med14	A	G	X: 12,719,697	I521T	probably benign	Het
Mia2	A	G	12: 59,154,410	K841E	probably damaging	Het
Mrgbp	G	A	2: 180,583,410	R53Q	possibly damaging	Het
Mrps18b	G	A	17: 35,910,854	S101L	probably benign	Het
Mum1l1	G	A	X: 139,236,680	G656S	possibly damaging	Het
Nmnat2	G	A	1: 153,112,425	V267I	probably benign	Het
Noc2l	A	G	4: 156,237,450	D102G	probably benign	Het
Ntn1	T	C	11: 68,385,864	E86G	probably benign	Het
Olfr1214	A	T	2: 88,987,320	I294K	probably benign	Het
Olfr231	A	G	1: 174,117,732	Y95H	probably damaging	Het
Olfr664	A	G	7: 104,734,218	F49L	probably benign	Het
Olfr715b	T	A	7: 107,106,468	H131L	probably benign	Het
Opn4	A	G	14: 34,593,828		probably null	Het
Pate3	T	A	9: 35,648,119	M1L	possibly damaging	Het
Pex2	A	G	3: 5,561,180	Y190H	probably damaging	Het
Pkhd1l1	A	C	15: 44,540,871	T2299P	probably damaging	Het
Ppp6r3	A	C	19: 3,521,782	S122R	possibly damaging	Het
Rnf113a1	A	G	X: 37,192,083	E231G	probably damaging	Het
Rnf41	T	C	10: 128,438,154	L225P	possibly damaging	Het
Rreb1	G	C	13: 37,932,453	A1263P	probably benign	Het
Rxfp1	A	G	3: 79,682,471	V121A	possibly damaging	Het
Slc35e4	A	T	11: 3,912,796	V131D	probably damaging	Het
Smyd4	T	A	11: 75,390,136	M145K	probably benign	Het
Snx13	T	A	12: 35,138,117	I798N	probably benign	Het
Srgap3	A	T	6: 112,722,972	F1015Y	probably damaging	Het
Synj1	T	C	16: 90,969,329	Y567C	probably damaging	Het
Tbc1d8	G	A	1: 39,402,696	Q272*	probably null	Het
Tinf2	T	C	14: 55,680,631	D127G	probably damaging	Het
Ube2v1	G	A	2: 167,617,965	P39L	probably damaging	Het
Vegfd	A	G	X: 164,385,883	E57G	probably damaging	Het
Vmn2r72	A	T	7: 85,750,836	I335N	probably damaging	Het
Zc3h6	A	G	2: 129,015,460	H633R	probably benign	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	not run
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CCGCAATCTTTAGAATACTCTGACAG -3'
(R):5'- TCCCGTGTAAAGCTGTAAAGTTC -3'

Sequencing Primer
(F):5'- TTACAAAGACTACTACAGTGCTTTC -3'
(R):5'- CTTGTTTGTGTAATCATGCACTGC -3'

Posted On

2014-12-04