Incidental Mutation 'R0312:Hlf'
ID25295
Institutional Source Beutler Lab
Gene Symbol Hlf
Ensembl Gene ENSMUSG00000003949
Gene Namehepatic leukemia factor
Synonyms
MMRRC Submission 038522-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R0312 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location90336536-90390895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90387875 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 121 (P121L)
Ref Sequence ENSEMBL: ENSMUSP00000004051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004051]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004051
AA Change: P121L

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004051
Gene: ENSMUSG00000003949
AA Change: P121L

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
low complexity region 98 111 N/A INTRINSIC
BRLZ 223 287 1.12e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145786
Predicted Effect unknown
Transcript: ENSMUST00000176001
AA Change: P33L
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the proline and acidic-rich (PAR) protein family, a subset of the bZIP transcription factors. The encoded protein forms homodimers or heterodimers with other PAR family members and binds sequence-specific promoter elements to activate transcription. Chromosomal translocations fusing portions of this gene with the E2A gene cause a subset of childhood B-lineage acute lymphoid leukemias. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Abcb5 G T 12: 118,872,837 A1113D probably damaging Het
Adcy1 G T 11: 7,149,538 A673S probably benign Het
Apob T A 12: 8,009,034 H2505Q probably benign Het
Arhgap12 A G 18: 6,061,982 probably benign Het
Bcl9 C T 3: 97,209,411 E656K probably benign Het
Bnc1 C T 7: 81,977,324 R106H possibly damaging Het
Ccdc54 T C 16: 50,590,802 K34E possibly damaging Het
Cfap65 G A 1: 74,904,067 R1600W probably damaging Het
Csmd1 A T 8: 15,984,760 N2470K probably damaging Het
Cspp1 T C 1: 10,058,829 probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dhx40 G A 11: 86,771,949 T639I probably damaging Het
Dlg1 A G 16: 31,790,267 T227A probably benign Het
Dnah10 G A 5: 124,796,369 probably benign Het
Dnah3 T A 7: 120,045,659 K1133M probably damaging Het
Dock5 G C 14: 67,795,991 F976L possibly damaging Het
Evc C T 5: 37,328,541 C97Y possibly damaging Het
Fbxw7 T C 3: 84,967,569 probably benign Het
Fggy A C 4: 95,844,185 D112A probably damaging Het
Fpgs A G 2: 32,684,801 Y435H probably damaging Het
Fryl T A 5: 73,072,888 H1642L probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gda T A 19: 21,417,005 I237F probably damaging Het
Glt1d1 A G 5: 127,691,070 N247S probably damaging Het
Gm7647 T C 5: 94,962,980 S7P probably benign Het
Gpr31b C T 17: 13,051,611 V224I probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ism1 G T 2: 139,678,672 M1I probably null Het
Kansl1l T C 1: 66,778,106 N365S probably null Het
Lama1 T C 17: 67,775,851 L1368P possibly damaging Het
Lima1 A G 15: 99,781,087 V491A possibly damaging Het
Lrch1 G T 14: 74,947,594 H23N possibly damaging Het
Lrp1b A G 2: 41,282,171 V1488A probably damaging Het
Lrp8 T C 4: 107,806,855 probably benign Het
Lrrc8e A G 8: 4,235,733 S653G probably benign Het
Mnat1 A G 12: 73,181,784 T141A possibly damaging Het
Mpeg1 C A 19: 12,462,403 N408K probably damaging Het
Myo7b T C 18: 32,014,337 E51G possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naa35 A G 13: 59,609,581 T257A probably benign Het
Obox5 T A 7: 15,757,560 H8Q probably damaging Het
Olfr196 A T 16: 59,167,839 F101L probably benign Het
Olfr350 A T 2: 36,850,360 I105L probably benign Het
Olfr638 T C 7: 104,004,025 V250A probably damaging Het
Phldb2 G T 16: 45,789,047 T732N probably damaging Het
Phyhip G T 14: 70,466,970 A210S possibly damaging Het
Pik3r4 A G 9: 105,686,210 D1262G probably damaging Het
Pip G A 6: 41,849,864 E48K possibly damaging Het
Plk4 C T 3: 40,813,547 L74F probably damaging Het
Prdm14 G A 1: 13,118,807 R438W probably damaging Het
Rab19 G A 6: 39,384,089 R57H probably benign Het
Rtl1 G T 12: 109,590,227 P1726Q probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skint6 A T 4: 112,809,100 V1176D possibly damaging Het
Slc12a1 A G 2: 125,226,028 I1012V probably damaging Het
Slc1a3 C T 15: 8,636,237 M509I probably benign Het
Spata18 G A 5: 73,666,881 G35E probably benign Het
Sspo C T 6: 48,455,401 P801L possibly damaging Het
Ugt2b37 C T 5: 87,250,665 G304D probably damaging Het
Vmn2r25 A T 6: 123,828,580 probably benign Het
Xrcc6 C A 15: 82,027,222 probably null Het
Other mutations in Hlf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1332:Hlf UTSW 11 90340853 nonsense probably null
R1863:Hlf UTSW 11 90340826 missense probably damaging 0.99
R3177:Hlf UTSW 11 90345835 missense probably damaging 1.00
R3277:Hlf UTSW 11 90345835 missense probably damaging 1.00
R3809:Hlf UTSW 11 90388103 missense probably benign 0.38
R5129:Hlf UTSW 11 90390252 missense probably benign
R5249:Hlf UTSW 11 90387806 missense probably benign 0.01
R7751:Hlf UTSW 11 90387995 missense probably damaging 0.99
X0023:Hlf UTSW 11 90345751 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCTACCCAAATTATCCAGCGAG -3'
(R):5'- GGACAAAACCCTTCCCTATGACGG -3'

Sequencing Primer
(F):5'- ccccagacccggaaaac -3'
(R):5'- TGACGGAGATACTTTCCAGC -3'
Posted On2013-04-16