Mutagenetix > Incidental Mutations

Incidental Mutation 'R2862:Greb1'

252958

Institutional Source

Beutler Lab

Gene Symbol

Greb1

Ensembl Gene

ENSMUSG00000036523

Gene Name

gene regulated by estrogen in breast cancer protein

Synonyms

5730583K22Rik

MMRRC Submission

040452-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16670615-16800886 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 16711745 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 545 (S545P)

Ref Sequence

ENSEMBL: ENSMUSP00000124348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]

Predicted Effect

probably benign
Transcript: ENSMUST00000048064
AA Change: S545P

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: S545P

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1954	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159044

Predicted Effect

probably benign
Transcript: ENSMUST00000159120
AA Change: S545P

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: S545P

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1100	1118	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1596	1607	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160347

SMART Domains

Protein: ENSMUSP00000124897
Gene: ENSMUSG00000036523

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	121	4.5e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160575

Predicted Effect

unknown
Transcript: ENSMUST00000160627
AA Change: S10P

SMART Domains

Protein: ENSMUSP00000124922
Gene: ENSMUSG00000036523
AA Change: S10P

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	122	1.8e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161036

Predicted Effect

probably benign
Transcript: ENSMUST00000162112
AA Change: S545P

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: S545P

Domain	Start	End	E-Value	Type
low complexity region	52	71	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	437	453	N/A	INTRINSIC
low complexity region	480	503	N/A	INTRINSIC
low complexity region	631	643	N/A	INTRINSIC
low complexity region	1128	1146	N/A	INTRINSIC
low complexity region	1224	1235	N/A	INTRINSIC
low complexity region	1279	1293	N/A	INTRINSIC
low complexity region	1624	1635	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	G	A	5: 31,485,911		probably benign	Het
Abca13	A	G	11: 9,309,057	S2928G	probably damaging	Het
Abcd1	T	A	X: 73,737,458	L713H	probably damaging	Het
Actg1	T	C	11: 120,346,801	I52V	probably benign	Het
Ahi1	T	A	10: 20,981,408	V634E	probably damaging	Het
Ang	G	T	14: 51,101,818	D139Y	probably damaging	Het
Apoe	T	C	7: 19,697,554	Y46C	probably damaging	Het
Aqr	A	T	2: 114,136,917	V539D	probably damaging	Het
Btg3	A	G	16: 78,364,980	V114A	probably damaging	Het
Cap1	A	T	4: 122,864,725	S221T	probably benign	Het
Cdca2	T	C	14: 67,698,090	E392G	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col22a1	A	G	15: 71,815,943		probably null	Het
Cyp2c38	G	A	19: 39,460,694	R72W	probably benign	Het
Dnah1	C	T	14: 31,284,762	G2199S	probably benign	Het
Dnhd1	A	G	7: 105,712,559	E3608G	probably benign	Het
Ears2	A	T	7: 122,062,940	L95Q	probably damaging	Het
F5	A	T	1: 164,184,964	K482N	probably damaging	Het
Gata5	C	T	2: 180,334,336	G12S	possibly damaging	Het
Gm11938	C	A	11: 99,603,146	R41L	probably damaging	Het
Grap2	A	T	15: 80,647,964	Q260L	probably damaging	Het
Iglc1	T	C	16: 19,061,910		probably benign	Het
Il18r1	T	C	1: 40,498,557	V494A	possibly damaging	Het
Kdf1	G	A	4: 133,528,541	E190K	probably damaging	Het
Lama2	G	A	10: 27,422,612	Q163*	probably null	Het
Lama3	G	T	18: 12,453,750	L723F	probably damaging	Het
Lamp5	A	T	2: 136,058,946	H22L	probably benign	Het
Maged1	G	A	X: 94,538,924	P366S	probably damaging	Het
Med14	A	G	X: 12,719,697	I521T	probably benign	Het
Mia2	A	G	12: 59,154,410	K841E	probably damaging	Het
Mrgbp	G	A	2: 180,583,410	R53Q	possibly damaging	Het
Mrps18b	G	A	17: 35,910,854	S101L	probably benign	Het
Mum1l1	G	A	X: 139,236,680	G656S	possibly damaging	Het
Nmnat2	G	A	1: 153,112,425	V267I	probably benign	Het
Noc2l	A	G	4: 156,237,450	D102G	probably benign	Het
Ntn1	T	C	11: 68,385,864	E86G	probably benign	Het
Olfr1214	A	T	2: 88,987,320	I294K	probably benign	Het
Olfr231	A	G	1: 174,117,732	Y95H	probably damaging	Het
Olfr664	A	G	7: 104,734,218	F49L	probably benign	Het
Olfr715b	T	A	7: 107,106,468	H131L	probably benign	Het
Opn4	A	G	14: 34,593,828		probably null	Het
Pate3	T	A	9: 35,648,119	M1L	possibly damaging	Het
Pex2	A	G	3: 5,561,180	Y190H	probably damaging	Het
Pkhd1l1	A	C	15: 44,540,871	T2299P	probably damaging	Het
Ppp6r3	A	C	19: 3,521,782	S122R	possibly damaging	Het
Rnf113a1	A	G	X: 37,192,083	E231G	probably damaging	Het
Rnf41	T	C	10: 128,438,154	L225P	possibly damaging	Het
Rreb1	G	C	13: 37,932,453	A1263P	probably benign	Het
Rxfp1	A	G	3: 79,682,471	V121A	possibly damaging	Het
Slc35e4	A	T	11: 3,912,796	V131D	probably damaging	Het
Smyd4	T	A	11: 75,390,136	M145K	probably benign	Het
Snx13	T	A	12: 35,138,117	I798N	probably benign	Het
Srgap3	A	T	6: 112,722,972	F1015Y	probably damaging	Het
Synj1	T	C	16: 90,969,329	Y567C	probably damaging	Het
Tbc1d8	G	A	1: 39,402,696	Q272*	probably null	Het
Tinf2	T	C	14: 55,680,631	D127G	probably damaging	Het
Ube2v1	G	A	2: 167,617,965	P39L	probably damaging	Het
Vegfd	A	G	X: 164,385,883	E57G	probably damaging	Het
Vmn2r72	A	T	7: 85,750,836	I335N	probably damaging	Het
Zc3h6	A	G	2: 129,015,460	H633R	probably benign	Het

Other mutations in Greb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Greb1	APN	12	16711961	missense	probably damaging	1.00
IGL01316:Greb1	APN	12	16698586	missense	probably benign	0.04
IGL01464:Greb1	APN	12	16714826	missense	probably damaging	0.99
IGL01474:Greb1	APN	12	16684501	missense	probably benign
IGL01522:Greb1	APN	12	16701201	missense	probably damaging	1.00
IGL01824:Greb1	APN	12	16711716	nonsense	probably null
IGL01837:Greb1	APN	12	16684451	missense	probably benign	0.19
IGL01991:Greb1	APN	12	16699681	missense	probably damaging	1.00
IGL01996:Greb1	APN	12	16690845	missense	possibly damaging	0.70
IGL02213:Greb1	APN	12	16706232	missense	probably damaging	1.00
IGL02267:Greb1	APN	12	16717208	missense	probably benign	0.00
IGL02512:Greb1	APN	12	16692712	missense	possibly damaging	0.79
IGL02583:Greb1	APN	12	16706295	splice site	probably benign
IGL02613:Greb1	APN	12	16739888	critical splice donor site	probably null
IGL02648:Greb1	APN	12	16708682	missense	probably damaging	1.00
IGL02679:Greb1	APN	12	16708723	missense	probably damaging	1.00
Eared	UTSW	12	16673863	missense	probably damaging	1.00
Humpback	UTSW	12	16701171	missense	probably damaging	1.00
pied_billed	UTSW	12	16724857	missense	possibly damaging	0.79
IGL03048:Greb1	UTSW	12	16733331	missense	probably damaging	1.00
R0083:Greb1	UTSW	12	16696451	missense	probably benign
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0100:Greb1	UTSW	12	16680224	missense	probably benign	0.41
R0220:Greb1	UTSW	12	16682286	missense	probably damaging	1.00
R0245:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0540:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0547:Greb1	UTSW	12	16723411	missense	probably benign
R0563:Greb1	UTSW	12	16680267	missense	probably benign	0.23
R0607:Greb1	UTSW	12	16682193	missense	probably damaging	1.00
R0610:Greb1	UTSW	12	16696442	missense	probably benign
R0652:Greb1	UTSW	12	16696456	missense	probably damaging	1.00
R0659:Greb1	UTSW	12	16680212	missense	probably damaging	0.99
R0945:Greb1	UTSW	12	16673802	missense	probably benign	0.31
R1055:Greb1	UTSW	12	16682251	missense	probably damaging	0.98
R1445:Greb1	UTSW	12	16707851	missense	probably damaging	1.00
R1471:Greb1	UTSW	12	16711774	missense	probably damaging	0.97
R1503:Greb1	UTSW	12	16724819	nonsense	probably null
R1566:Greb1	UTSW	12	16711828	missense	possibly damaging	0.94
R1614:Greb1	UTSW	12	16701171	missense	probably damaging	1.00
R1623:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R1751:Greb1	UTSW	12	16723438	splice site	probably benign
R1778:Greb1	UTSW	12	16690894	missense	probably benign
R1842:Greb1	UTSW	12	16696243	missense	probably damaging	1.00
R2040:Greb1	UTSW	12	16702650	missense	probably damaging	1.00
R2153:Greb1	UTSW	12	16699532	missense	probably damaging	1.00
R2178:Greb1	UTSW	12	16696387	missense	probably damaging	1.00
R2194:Greb1	UTSW	12	16690908	missense	probably benign	0.08
R2248:Greb1	UTSW	12	16680378	missense	possibly damaging	0.90
R2474:Greb1	UTSW	12	16714953	missense	possibly damaging	0.93
R2509:Greb1	UTSW	12	16724922	missense	probably damaging	1.00
R2860:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2861:Greb1	UTSW	12	16711745	missense	probably benign	0.28
R2866:Greb1	UTSW	12	16699550	missense	probably damaging	1.00
R2890:Greb1	UTSW	12	16704478	missense	probably damaging	1.00
R3056:Greb1	UTSW	12	16688591	missense	probably damaging	0.96
R3863:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3864:Greb1	UTSW	12	16702420	missense	probably damaging	1.00
R3956:Greb1	UTSW	12	16682299	missense	probably damaging	1.00
R4493:Greb1	UTSW	12	16698610	missense	probably benign	0.14
R4548:Greb1	UTSW	12	16699675	missense	probably damaging	1.00
R4683:Greb1	UTSW	12	16711773	missense	possibly damaging	0.75
R4739:Greb1	UTSW	12	16696328	missense	probably damaging	1.00
R4770:Greb1	UTSW	12	16681356	missense	probably benign	0.03
R4838:Greb1	UTSW	12	16684360	critical splice donor site	probably null
R4925:Greb1	UTSW	12	16681471	missense	probably damaging	1.00
R4982:Greb1	UTSW	12	16724761	missense	probably damaging	0.98
R5009:Greb1	UTSW	12	16724857	missense	possibly damaging	0.79
R5086:Greb1	UTSW	12	16708022	intron	probably benign
R5213:Greb1	UTSW	12	16714790	nonsense	probably null
R5310:Greb1	UTSW	12	16716759	missense	probably benign	0.09
R5353:Greb1	UTSW	12	16688566	nonsense	probably null
R5544:Greb1	UTSW	12	16673796	missense	probably damaging	1.00
R5605:Greb1	UTSW	12	16708726	missense	probably damaging	0.96
R5708:Greb1	UTSW	12	16673842	missense	probably benign	0.11
R5837:Greb1	UTSW	12	16688585	missense	probably damaging	1.00
R5890:Greb1	UTSW	12	16733421	missense	possibly damaging	0.90
R5938:Greb1	UTSW	12	16717258	missense	probably damaging	1.00
R6049:Greb1	UTSW	12	16681394	missense	probably damaging	0.99
R6093:Greb1	UTSW	12	16684486	missense	probably benign
R6120:Greb1	UTSW	12	16708621	missense	probably damaging	0.99
R6175:Greb1	UTSW	12	16674770	missense	probably damaging	1.00
R6247:Greb1	UTSW	12	16716675	missense	probably damaging	1.00
R6274:Greb1	UTSW	12	16735151	missense	probably damaging	0.97
R6376:Greb1	UTSW	12	16699579	missense	probably damaging	0.97
R6523:Greb1	UTSW	12	16684373	missense	possibly damaging	0.51
R6557:Greb1	UTSW	12	16710383	missense	probably benign	0.00
R6602:Greb1	UTSW	12	16709440	missense	probably benign	0.44
R6621:Greb1	UTSW	12	16692717	missense	probably damaging	1.00
R6645:Greb1	UTSW	12	16698579	missense	probably benign	0.07
R6725:Greb1	UTSW	12	16688567	missense	probably damaging	1.00
R6750:Greb1	UTSW	12	16688583	missense	probably benign	0.05
R6863:Greb1	UTSW	12	16684420	missense	probably damaging	1.00
R6914:Greb1	UTSW	12	16707902	missense	probably damaging	0.97
R6996:Greb1	UTSW	12	16723354	missense	probably benign	0.00
R7083:Greb1	UTSW	12	16723314	missense	probably benign
R7147:Greb1	UTSW	12	16733427	missense	probably damaging	1.00
R7238:Greb1	UTSW	12	16674672	missense	probably damaging	0.99
R7290:Greb1	UTSW	12	16711738	missense	probably damaging	1.00
R7358:Greb1	UTSW	12	16724881	missense	probably damaging	1.00
R7395:Greb1	UTSW	12	16709430	critical splice donor site	probably null
R7526:Greb1	UTSW	12	16716765	missense	probably benign	0.00
R7530:Greb1	UTSW	12	16717206	missense	probably benign	0.02
R7536:Greb1	UTSW	12	16682185	missense	probably damaging	1.00
R7643:Greb1	UTSW	12	16711996	missense	probably damaging	0.99
R7732:Greb1	UTSW	12	16673863	missense	probably damaging	1.00
R7740:Greb1	UTSW	12	16740121	start gained	probably benign
R7747:Greb1	UTSW	12	16674795	missense	probably benign	0.01
R7760:Greb1	UTSW	12	16723416	missense	probably benign
R7937:Greb1	UTSW	12	16716669	missense	probably damaging	0.99
R8043:Greb1	UTSW	12	16711789	missense	probably damaging	1.00
R8259:Greb1	UTSW	12	16724924	nonsense	probably null
R8553:Greb1	UTSW	12	16723327	missense	probably benign	0.00
Z1176:Greb1	UTSW	12	16696756	missense	probably benign	0.00
Z1177:Greb1	UTSW	12	16702491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCAGCATGGACTAAGGAAC -3'
(R):5'- ATAAGGCAGTACCAGCAGGC -3'

Sequencing Primer
(F):5'- TGGACTAAGGAACTAACTGCC -3'
(R):5'- AGTACCAGCAGGCGCCTC -3'

Posted On

2014-12-04