Incidental Mutation 'R0312:Apob'
ID25296
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 038522-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R0312 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8009034 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 2505 (H2505Q)
Ref Sequence ENSEMBL: ENSMUSP00000036044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]
Predicted Effect probably benign
Transcript: ENSMUST00000037520
AA Change: H2472Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: H2472Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037811
AA Change: H2505Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: H2505Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171239
SMART Domains Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609

DomainStartEndE-ValueType
low complexity region 348 356 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Abcb5 G T 12: 118,872,837 A1113D probably damaging Het
Adcy1 G T 11: 7,149,538 A673S probably benign Het
Arhgap12 A G 18: 6,061,982 probably benign Het
Bcl9 C T 3: 97,209,411 E656K probably benign Het
Bnc1 C T 7: 81,977,324 R106H possibly damaging Het
Ccdc54 T C 16: 50,590,802 K34E possibly damaging Het
Cfap65 G A 1: 74,904,067 R1600W probably damaging Het
Csmd1 A T 8: 15,984,760 N2470K probably damaging Het
Cspp1 T C 1: 10,058,829 probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dhx40 G A 11: 86,771,949 T639I probably damaging Het
Dlg1 A G 16: 31,790,267 T227A probably benign Het
Dnah10 G A 5: 124,796,369 probably benign Het
Dnah3 T A 7: 120,045,659 K1133M probably damaging Het
Dock5 G C 14: 67,795,991 F976L possibly damaging Het
Evc C T 5: 37,328,541 C97Y possibly damaging Het
Fbxw7 T C 3: 84,967,569 probably benign Het
Fggy A C 4: 95,844,185 D112A probably damaging Het
Fpgs A G 2: 32,684,801 Y435H probably damaging Het
Fryl T A 5: 73,072,888 H1642L probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gda T A 19: 21,417,005 I237F probably damaging Het
Glt1d1 A G 5: 127,691,070 N247S probably damaging Het
Gm7647 T C 5: 94,962,980 S7P probably benign Het
Gpr31b C T 17: 13,051,611 V224I probably damaging Het
Hlf G A 11: 90,387,875 P121L possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ism1 G T 2: 139,678,672 M1I probably null Het
Kansl1l T C 1: 66,778,106 N365S probably null Het
Lama1 T C 17: 67,775,851 L1368P possibly damaging Het
Lima1 A G 15: 99,781,087 V491A possibly damaging Het
Lrch1 G T 14: 74,947,594 H23N possibly damaging Het
Lrp1b A G 2: 41,282,171 V1488A probably damaging Het
Lrp8 T C 4: 107,806,855 probably benign Het
Lrrc8e A G 8: 4,235,733 S653G probably benign Het
Mnat1 A G 12: 73,181,784 T141A possibly damaging Het
Mpeg1 C A 19: 12,462,403 N408K probably damaging Het
Myo7b T C 18: 32,014,337 E51G possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naa35 A G 13: 59,609,581 T257A probably benign Het
Obox5 T A 7: 15,757,560 H8Q probably damaging Het
Olfr196 A T 16: 59,167,839 F101L probably benign Het
Olfr350 A T 2: 36,850,360 I105L probably benign Het
Olfr638 T C 7: 104,004,025 V250A probably damaging Het
Phldb2 G T 16: 45,789,047 T732N probably damaging Het
Phyhip G T 14: 70,466,970 A210S possibly damaging Het
Pik3r4 A G 9: 105,686,210 D1262G probably damaging Het
Pip G A 6: 41,849,864 E48K possibly damaging Het
Plk4 C T 3: 40,813,547 L74F probably damaging Het
Prdm14 G A 1: 13,118,807 R438W probably damaging Het
Rab19 G A 6: 39,384,089 R57H probably benign Het
Rtl1 G T 12: 109,590,227 P1726Q probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skint6 A T 4: 112,809,100 V1176D possibly damaging Het
Slc12a1 A G 2: 125,226,028 I1012V probably damaging Het
Slc1a3 C T 15: 8,636,237 M509I probably benign Het
Spata18 G A 5: 73,666,881 G35E probably benign Het
Sspo C T 6: 48,455,401 P801L possibly damaging Het
Ugt2b37 C T 5: 87,250,665 G304D probably damaging Het
Vmn2r25 A T 6: 123,828,580 probably benign Het
Xrcc6 C A 15: 82,027,222 probably null Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
Aesthete UTSW 12 8010080 nonsense probably null
Essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 splice site probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
R7474:Apob UTSW 12 8009185 missense probably benign 0.29
R7484:Apob UTSW 12 8006884 nonsense probably null
R7538:Apob UTSW 12 8002219 missense probably damaging 0.98
R7636:Apob UTSW 12 8009516 missense possibly damaging 0.86
R7646:Apob UTSW 12 8009189 missense probably damaging 0.99
R7787:Apob UTSW 12 7990780 missense probably damaging 0.97
R7793:Apob UTSW 12 8008124 missense probably damaging 0.99
R7836:Apob UTSW 12 8001885 missense possibly damaging 0.72
R7895:Apob UTSW 12 8011933 missense probably benign 0.00
R8005:Apob UTSW 12 8009744 missense probably benign 0.01
R8013:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8014:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8111:Apob UTSW 12 8008801 missense probably benign 0.16
R8117:Apob UTSW 12 8006435 missense probably damaging 0.99
R8226:Apob UTSW 12 8009056 missense probably benign 0.00
R8244:Apob UTSW 12 8010548 missense probably damaging 0.96
R8280:Apob UTSW 12 8010851 missense possibly damaging 0.46
R8310:Apob UTSW 12 8009033 missense probably benign 0.00
R8327:Apob UTSW 12 8001015 missense possibly damaging 0.72
R8329:Apob UTSW 12 8011135 missense probably damaging 0.98
R8331:Apob UTSW 12 8001882 missense probably benign 0.28
R8351:Apob UTSW 12 8006356 missense probably benign 0.29
R8412:Apob UTSW 12 8008069 missense probably benign 0.33
R8425:Apob UTSW 12 7988842 missense possibly damaging 0.70
R8493:Apob UTSW 12 8009009 missense possibly damaging 0.87
R8529:Apob UTSW 12 8007353 missense probably damaging 1.00
R8554:Apob UTSW 12 7987830 missense probably damaging 0.98
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Z1176:Apob UTSW 12 7998011 missense probably damaging 1.00
Z1176:Apob UTSW 12 8004978 missense probably benign 0.00
Z1177:Apob UTSW 12 7988765 missense probably benign 0.43
Z1177:Apob UTSW 12 8015249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGCGAGCCTCTTCAGAAACTCAG -3'
(R):5'- TCAAAAGCAGGCATGGTCCACAG -3'

Sequencing Primer
(F):5'- GCCTCTTCAGAAACTCAGTAATGTG -3'
(R):5'- CATGGTCCACAGAAATGTTTGC -3'
Posted On2013-04-16