Incidental Mutation 'R2862:Dnah1'
ID252967
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 040452-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2862 (G1)
Quality Score196
Status Not validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31284762 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 2199 (G2199S)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably benign
Transcript: ENSMUST00000048603
AA Change: G2199S

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: G2199S

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228927
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,485,911 probably benign Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ahi1 T A 10: 20,981,408 V634E probably damaging Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Aqr A T 2: 114,136,917 V539D probably damaging Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cdca2 T C 14: 67,698,090 E392G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col22a1 A G 15: 71,815,943 probably null Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Dnhd1 A G 7: 105,712,559 E3608G probably benign Het
Ears2 A T 7: 122,062,940 L95Q probably damaging Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Gata5 C T 2: 180,334,336 G12S possibly damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Grap2 A T 15: 80,647,964 Q260L probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama2 G A 10: 27,422,612 Q163* probably null Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lamp5 A T 2: 136,058,946 H22L probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mrps18b G A 17: 35,910,854 S101L probably benign Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Noc2l A G 4: 156,237,450 D102G probably benign Het
Ntn1 T C 11: 68,385,864 E86G probably benign Het
Olfr1214 A T 2: 88,987,320 I294K probably benign Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr664 A G 7: 104,734,218 F49L probably benign Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Pate3 T A 9: 35,648,119 M1L possibly damaging Het
Pex2 A G 3: 5,561,180 Y190H probably damaging Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Rreb1 G C 13: 37,932,453 A1263P probably benign Het
Rxfp1 A G 3: 79,682,471 V121A possibly damaging Het
Slc35e4 A T 11: 3,912,796 V131D probably damaging Het
Smyd4 T A 11: 75,390,136 M145K probably benign Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Srgap3 A T 6: 112,722,972 F1015Y probably damaging Het
Synj1 T C 16: 90,969,329 Y567C probably damaging Het
Tbc1d8 G A 1: 39,402,696 Q272* probably null Het
Tinf2 T C 14: 55,680,631 D127G probably damaging Het
Ube2v1 G A 2: 167,617,965 P39L probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Zc3h6 A G 2: 129,015,460 H633R probably benign Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
Faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31261590 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31300791 missense possibly damaging 0.80
R7499:Dnah1 UTSW 14 31315122 nonsense probably null
R7526:Dnah1 UTSW 14 31287876 missense possibly damaging 0.49
R7560:Dnah1 UTSW 14 31304983 missense probably benign
R7574:Dnah1 UTSW 14 31319908 missense probably benign 0.00
R7617:Dnah1 UTSW 14 31284782 missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31303906 missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31292338 missense probably benign 0.00
R7702:Dnah1 UTSW 14 31310909 missense probably benign
R7786:Dnah1 UTSW 14 31262521 missense probably damaging 1.00
RF006:Dnah1 UTSW 14 31307875 missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GATACACAGCACCTGGGAAC -3'
(R):5'- TGATGTTCTTGCCGATGCCC -3'

Sequencing Primer
(F):5'- ACCTGGGAACGTGGTGAGC -3'
(R):5'- GCGGGACAATACCTCTTCC -3'
Posted On2014-12-04