Incidental Mutation 'R2862:Btg3'
ID252984
Institutional Source Beutler Lab
Gene Symbol Btg3
Ensembl Gene ENSMUSG00000022863
Gene NameB cell translocation gene 3
Synonymstob5, ANA
MMRRC Submission 040452-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R2862 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location78332637-78377192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78364980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000023570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023570] [ENSMUST00000148124] [ENSMUST00000231353]
Predicted Effect probably damaging
Transcript: ENSMUST00000023570
AA Change: V114A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023570
Gene: ENSMUSG00000022863
AA Change: V114A

DomainStartEndE-ValueType
btg1 1 108 1.28e-81 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 206 216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148124
AA Change: V114A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119706
Gene: ENSMUSG00000022863
AA Change: V114A

DomainStartEndE-ValueType
btg1 1 108 1.28e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231353
AA Change: V87A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.7792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes B cell translocation gene 3, a member of the BTG gene family. This family is defined by a conserved N-terminal domain, known to bind transcription factors, and a less conserved C-terminal domain. This protein is thought to have anti-proliferative properties, and may be involved in regulating the G1-S transition to suppress cell cycle progression. Mice deficient for this gene display an increased incidence of lung cancers, and many human lung cancer cells exhibit decreased levels of B cell translocation gene 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,485,911 probably benign Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ahi1 T A 10: 20,981,408 V634E probably damaging Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Aqr A T 2: 114,136,917 V539D probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cdca2 T C 14: 67,698,090 E392G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col22a1 A G 15: 71,815,943 probably null Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Dnah1 C T 14: 31,284,762 G2199S probably benign Het
Dnhd1 A G 7: 105,712,559 E3608G probably benign Het
Ears2 A T 7: 122,062,940 L95Q probably damaging Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Gata5 C T 2: 180,334,336 G12S possibly damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Grap2 A T 15: 80,647,964 Q260L probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama2 G A 10: 27,422,612 Q163* probably null Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lamp5 A T 2: 136,058,946 H22L probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mrps18b G A 17: 35,910,854 S101L probably benign Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Noc2l A G 4: 156,237,450 D102G probably benign Het
Ntn1 T C 11: 68,385,864 E86G probably benign Het
Olfr1214 A T 2: 88,987,320 I294K probably benign Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr664 A G 7: 104,734,218 F49L probably benign Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Pate3 T A 9: 35,648,119 M1L possibly damaging Het
Pex2 A G 3: 5,561,180 Y190H probably damaging Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Rreb1 G C 13: 37,932,453 A1263P probably benign Het
Rxfp1 A G 3: 79,682,471 V121A possibly damaging Het
Slc35e4 A T 11: 3,912,796 V131D probably damaging Het
Smyd4 T A 11: 75,390,136 M145K probably benign Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Srgap3 A T 6: 112,722,972 F1015Y probably damaging Het
Synj1 T C 16: 90,969,329 Y567C probably damaging Het
Tbc1d8 G A 1: 39,402,696 Q272* probably null Het
Tinf2 T C 14: 55,680,631 D127G probably damaging Het
Ube2v1 G A 2: 167,617,965 P39L probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Zc3h6 A G 2: 129,015,460 H633R probably benign Het
Other mutations in Btg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0578:Btg3 UTSW 16 78364946 missense probably benign 0.24
R1467:Btg3 UTSW 16 78364800 critical splice donor site probably null
R1467:Btg3 UTSW 16 78364800 critical splice donor site probably null
R2860:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R2861:Btg3 UTSW 16 78364980 missense probably damaging 1.00
R3698:Btg3 UTSW 16 78364834 missense probably benign
R6938:Btg3 UTSW 16 78360328 missense probably benign 0.01
R7336:Btg3 UTSW 16 78364807 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACTGTGATTGGCTGGAGAAG -3'
(R):5'- GCGCTCTGGGTATTAAATGTGC -3'

Sequencing Primer
(F):5'- GCGGGTCTTACCTGGTACAC -3'
(R):5'- AAATGTGCATGGTCTAGCTCTG -3'
Posted On2014-12-04