Incidental Mutation 'R2862:Synj1'
ID 252986
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Name synaptojanin 1
Synonyms
MMRRC Submission 040452-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2862 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 90936092-91011308 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90969329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 567 (Y567C)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853] [ENSMUST00000231472]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118246
Predicted Effect unknown
Transcript: ENSMUST00000118390
AA Change: Y541C
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: Y541C

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121759
AA Change: Y567C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: Y567C

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130813
AA Change: Y522C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973
AA Change: Y522C

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170853
AA Change: Y527C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: Y527C

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231472
AA Change: Y6C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,485,911 probably benign Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ahi1 T A 10: 20,981,408 V634E probably damaging Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Aqr A T 2: 114,136,917 V539D probably damaging Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cdca2 T C 14: 67,698,090 E392G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col22a1 A G 15: 71,815,943 probably null Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Dnah1 C T 14: 31,284,762 G2199S probably benign Het
Dnhd1 A G 7: 105,712,559 E3608G probably benign Het
Ears2 A T 7: 122,062,940 L95Q probably damaging Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Gata5 C T 2: 180,334,336 G12S possibly damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Grap2 A T 15: 80,647,964 Q260L probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama2 G A 10: 27,422,612 Q163* probably null Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lamp5 A T 2: 136,058,946 H22L probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mrps18b G A 17: 35,910,854 S101L probably benign Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Noc2l A G 4: 156,237,450 D102G probably benign Het
Ntn1 T C 11: 68,385,864 E86G probably benign Het
Olfr1214 A T 2: 88,987,320 I294K probably benign Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr664 A G 7: 104,734,218 F49L probably benign Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Pate3 T A 9: 35,648,119 M1L possibly damaging Het
Pex2 A G 3: 5,561,180 Y190H probably damaging Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Rreb1 G C 13: 37,932,453 A1263P probably benign Het
Rxfp1 A G 3: 79,682,471 V121A possibly damaging Het
Slc35e4 A T 11: 3,912,796 V131D probably damaging Het
Smyd4 T A 11: 75,390,136 M145K probably benign Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Srgap3 A T 6: 112,722,972 F1015Y probably damaging Het
Tbc1d8 G A 1: 39,402,696 Q272* probably null Het
Tinf2 T C 14: 55,680,631 D127G probably damaging Het
Ube2v1 G A 2: 167,617,965 P39L probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Zc3h6 A G 2: 129,015,460 H633R probably benign Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90951976 missense probably damaging 1.00
IGL01468:Synj1 APN 16 91010172 splice site probably benign
IGL02209:Synj1 APN 16 90987419 missense probably damaging 0.97
IGL02452:Synj1 APN 16 90961365 splice site probably benign
IGL02619:Synj1 APN 16 90974045 missense probably damaging 1.00
IGL02650:Synj1 APN 16 90976696 missense probably benign 0.03
IGL02708:Synj1 APN 16 90991462 missense probably damaging 1.00
IGL02863:Synj1 APN 16 90961434 missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90988168 missense probably damaging 0.99
IGL03295:Synj1 APN 16 90938430 missense probably benign 0.14
IGL03356:Synj1 APN 16 90987392 missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90964508 missense probably damaging 1.00
R0179:Synj1 UTSW 16 90964631 missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90938640 missense probably benign
R0426:Synj1 UTSW 16 90967354 missense probably damaging 1.00
R0486:Synj1 UTSW 16 90938263 utr 3 prime probably benign
R0515:Synj1 UTSW 16 90994022 missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90948087 missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0698:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0945:Synj1 UTSW 16 90960445 missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90946855 missense probably benign 0.05
R1562:Synj1 UTSW 16 90987402 missense probably benign 0.09
R1732:Synj1 UTSW 16 90964230 missense probably damaging 0.99
R1752:Synj1 UTSW 16 90938473 missense probably benign
R1785:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R1786:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R2011:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2012:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2065:Synj1 UTSW 16 90991649 critical splice acceptor site probably null
R3026:Synj1 UTSW 16 90978734 missense probably damaging 1.00
R3151:Synj1 UTSW 16 90960626 missense probably damaging 0.96
R3946:Synj1 UTSW 16 91010096 missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90991603 missense probably damaging 1.00
R4472:Synj1 UTSW 16 90969181 critical splice donor site probably null
R4547:Synj1 UTSW 16 90988282 missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90973989 missense probably damaging 1.00
R4739:Synj1 UTSW 16 90955419 missense probably benign 0.00
R5027:Synj1 UTSW 16 90940519 splice site probably null
R5428:Synj1 UTSW 16 90991518 missense probably damaging 0.98
R5586:Synj1 UTSW 16 91009977 intron probably benign
R5769:Synj1 UTSW 16 90938253 utr 3 prime probably benign
R6005:Synj1 UTSW 16 90969286 missense probably damaging 1.00
R6119:Synj1 UTSW 16 90938989 missense probably benign 0.30
R6313:Synj1 UTSW 16 90946815 missense probably benign 0.00
R6324:Synj1 UTSW 16 90938630 missense probably benign 0.00
R6549:Synj1 UTSW 16 90938677 missense probably benign
R6696:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6698:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6861:Synj1 UTSW 16 90963880 nonsense probably null
R7008:Synj1 UTSW 16 90993945 missense probably damaging 1.00
R7153:Synj1 UTSW 16 90948090 missense probably benign 0.04
R7393:Synj1 UTSW 16 90951999 missense probably damaging 0.99
R7510:Synj1 UTSW 16 90938677 missense probably benign
R7560:Synj1 UTSW 16 90940483 missense probably benign
R7724:Synj1 UTSW 16 90961499 missense probably damaging 0.99
R7913:Synj1 UTSW 16 90991427 missense possibly damaging 0.83
R8326:Synj1 UTSW 16 90988196 missense probably benign 0.12
R8707:Synj1 UTSW 16 90955431 missense probably benign 0.02
R8711:Synj1 UTSW 16 91010083 missense probably damaging 0.98
R8767:Synj1 UTSW 16 90961518 missense probably damaging 1.00
R8911:Synj1 UTSW 16 90978734 missense probably damaging 1.00
R9052:Synj1 UTSW 16 90938840 missense probably benign 0.00
R9124:Synj1 UTSW 16 90938625 missense probably benign 0.00
R9307:Synj1 UTSW 16 90988207 missense probably damaging 0.98
R9408:Synj1 UTSW 16 90944852 missense probably benign 0.27
Z1176:Synj1 UTSW 16 90987340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGTCACATTGCAGTCAG -3'
(R):5'- GCATTCAAGGCTGATCTCTCC -3'

Sequencing Primer
(F):5'- GTGTCACATTGCAGTCAGGACTTC -3'
(R):5'- AAGGCTGATCTCTCCCTTGTG -3'
Posted On 2014-12-04