Mutagenetix > Incidental Mutations

Incidental Mutation 'R2511:Sstr2'

252999

Institutional Source

Beutler Lab

Gene Symbol

Sstr2

Ensembl Gene

ENSMUSG00000047904

Gene Name

somatostatin receptor 2

Synonyms

SSTR-2, Smstr2, Smstr-2, sst2

MMRRC Submission

040417-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.723) question?

Stock #

R2511 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113619342-113626028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113624923 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 223 (I223F)

Ref Sequence

ENSEMBL: ENSMUSP00000138101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067591
AA Change: I223F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904
AA Change: I223F

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	281	1.1e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	1.9e-20	PFAM
Pfam:7tm_1	60	312	2.5e-70	PFAM
Pfam:7TM_GPCR_Srv	118	329	4.9e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106630
AA Change: I223F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904
AA Change: I223F

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	284	1.3e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	1.9e-20	PFAM
Pfam:7tm_1	60	312	1.4e-65	PFAM
Pfam:7TM_GPCR_Srv	119	328	4.3e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123153

Predicted Effect

probably benign
Transcript: ENSMUST00000125890

SMART Domains

Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

Domain	Start	End	E-Value	Type
Pfam:Zip	7	200	3.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136392

Predicted Effect

probably benign
Transcript: ENSMUST00000146031

SMART Domains

Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	39	61	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000146390
AA Change: I223F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: I223F

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	284	1.8e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	2.4e-20	PFAM
Pfam:7tm_1	60	312	3.1e-70	PFAM
Pfam:7TM_GPCR_Srv	118	329	5.7e-13	PFAM

Meta Mutation Damage Score

0.3193

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,625,300	M506V	probably benign	Het
9330159F19Rik	T	A	10: 29,221,906	C100S	probably damaging	Het
Abcc8	C	T	7: 46,150,780	R526H	probably damaging	Het
Acad10	G	A	5: 121,631,567	P609S	probably benign	Het
Acod1	A	T	14: 103,051,339	D95V	probably damaging	Het
Acsm5	A	T	7: 119,530,454	I130F	possibly damaging	Het
Ago4	A	T	4: 126,517,071	D208E	probably damaging	Het
Agrn	A	T	4: 156,166,424		probably null	Het
Ankar	A	T	1: 72,658,694	I791K	probably damaging	Het
Ano10	A	G	9: 122,258,945	V364A	probably damaging	Het
Arhgap9	T	C	10: 127,328,985		probably null	Het
Arsi	G	A	18: 60,916,594	C183Y	probably damaging	Het
Ascl2	T	G	7: 142,968,216	E97A	probably damaging	Het
Asna1	A	G	8: 85,019,766	V151A	possibly damaging	Het
Bcl2a1a	C	T	9: 88,957,453	R135W	probably damaging	Het
Bms1	C	T	6: 118,391,153		probably null	Het
Bysl	T	A	17: 47,604,335	T163S	probably benign	Het
Card10	A	G	15: 78,780,273	I821T	probably benign	Het
Cc2d2a	A	T	5: 43,735,395	Q1433L	probably damaging	Het
Cchcr1	T	C	17: 35,530,513	S809P	probably benign	Het
Ccz1	G	T	5: 144,012,997	T70K	probably damaging	Het
Cdc25c	G	C	18: 34,738,239	L275V	probably damaging	Het
Cep164	A	T	9: 45,775,249	L729Q	probably damaging	Het
Clcn6	A	G	4: 148,017,494		probably null	Het
Clcn7	T	A	17: 25,155,446	V507E	probably damaging	Het
Ctso	A	C	3: 81,932,734	T24P	probably damaging	Het
Dis3l2	A	T	1: 86,990,258	N543I	probably benign	Het
Dnah12	A	T	14: 26,769,950	Y1114F	possibly damaging	Het
Emx1	A	G	6: 85,204,051	D250G	probably benign	Het
Epha4	G	A	1: 77,511,702	A47V	possibly damaging	Het
Fam149b	A	C	14: 20,378,456	N341T	probably damaging	Het
Fsip2	A	G	2: 82,951,657	K62R	probably damaging	Het
Fsip2	T	C	2: 82,986,438	S4172P	probably benign	Het
Gbp3	A	G	3: 142,570,582	R480G	probably benign	Het
Gja8	T	G	3: 96,919,717	T210P	probably damaging	Het
Gm13103	G	A	4: 143,851,991	V274I	probably benign	Het
Gm5431	T	A	11: 48,888,709	N740I	probably benign	Het
Gm9930	T	C	10: 9,534,702		noncoding transcript	Het
Gstt4	C	T	10: 75,815,125	C221Y	probably benign	Het
Gzmg	A	T	14: 56,158,375	D42E	probably benign	Het
Hoxd12	G	A	2: 74,675,471	A129T	possibly damaging	Het
Hs2st1	G	A	3: 144,569,930		probably benign	Het
Ifnlr1	G	T	4: 135,705,248	D332Y	probably damaging	Het
Igsf10	T	C	3: 59,331,866	D298G	probably damaging	Het
Irf1	T	C	11: 53,773,791	V108A	probably damaging	Het
Jsrp1	C	G	10: 80,812,306	S36T	probably benign	Het
Kcnq5	T	A	1: 21,505,782	R233*	probably null	Het
Kif7	T	C	7: 79,702,264	K917E	probably damaging	Het
Krt7	A	C	15: 101,412,657	I62L	probably benign	Het
Lifr	A	G	15: 7,166,916	T194A	probably benign	Het
Ltbp2	T	C	12: 84,804,409		probably null	Het
Man2c1	A	G	9: 57,141,388		probably null	Het
Met	T	C	6: 17,491,967	S243P	probably damaging	Het
Mllt10	C	A	2: 18,065,124	D30E	possibly damaging	Het
Mre11a	A	C	9: 14,795,769		probably null	Het
Mroh9	A	G	1: 163,038,945	S710P	probably benign	Het
Mvk	C	A	5: 114,450,398	Y116*	probably null	Het
Myh1	A	G	11: 67,205,597	I301V	probably benign	Het
Ncf1	T	C	5: 134,225,698	D184G	probably damaging	Het
Nxpe4	T	C	9: 48,393,233	F207L	probably damaging	Het
Olfr10	T	G	11: 49,318,221	L225R	probably damaging	Het
Olfr1137	T	C	2: 87,711,048	N286S	probably damaging	Het
Olfr1301	T	A	2: 111,754,316	N22K	probably benign	Het
Olfr1449	T	A	19: 12,935,173	M145K	possibly damaging	Het
Olfr690	A	T	7: 105,329,610	I194N	probably damaging	Het
Olfr700	G	T	7: 106,805,961	P167H	probably damaging	Het
Pcdh1	G	A	18: 38,199,479	T296M	possibly damaging	Het
Pcdh15	A	G	10: 74,645,996	D391G	possibly damaging	Het
Pcdha7	C	A	18: 36,974,733	D270E	probably damaging	Het
Pgam1	C	A	19: 41,915,876	S137R	probably damaging	Het
Pitpnm2	T	C	5: 124,136,326	E240G	probably damaging	Het
Plce1	T	G	19: 38,760,054	I1729S	probably damaging	Het
Plppr4	G	T	3: 117,331,706	N161K	probably damaging	Het
Prkce	T	A	17: 86,625,326	I578N	probably damaging	Het
Prss58	A	C	6: 40,897,800	S36A	probably damaging	Het
Ptprm	T	C	17: 66,693,778	H1128R	probably damaging	Het
Rgs9	T	C	11: 109,268,972	Y178C	probably benign	Het
Rubcn	T	C	16: 32,847,254	N179S	probably damaging	Het
Sh3bp1	C	T	15: 78,911,506	P612S	probably damaging	Het
Sh3bp5	G	A	14: 31,411,629	T82M	probably damaging	Het
Shank2	A	G	7: 144,411,577	Y974C	probably damaging	Het
Slc9c1	T	C	16: 45,544,736	I144T	possibly damaging	Het
Slf2	T	C	19: 44,941,606	I374T	possibly damaging	Het
Snx13	A	G	12: 35,138,081	D786G	probably benign	Het
Spcs3	A	G	8: 54,523,354	V151A	possibly damaging	Het
Stac3	T	C	10: 127,503,918		probably null	Het
Tas1r2	A	G	4: 139,659,851	N207S	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Tgm5	T	C	2: 121,076,948	E98G	possibly damaging	Het
Tktl2	A	G	8: 66,512,852	E354G	probably benign	Het
Tmem57	A	G	4: 134,804,388	S657P	probably damaging	Het
Tmem94	G	A	11: 115,791,961	R608H	probably damaging	Het
Tnrc6a	G	A	7: 123,171,092	V702I	probably damaging	Het
Trappc10	A	G	10: 78,211,523	S380P	possibly damaging	Het
Trim24	G	A	6: 37,903,652		probably null	Het
Ugt1a2	A	G	1: 88,201,124	Y163C	probably damaging	Het
Vmn1r215	A	G	13: 23,076,173	I128V	probably benign	Het
Vmn2r50	T	A	7: 10,047,713	E368D	possibly damaging	Het
Vmn2r59	T	C	7: 42,043,766	N470S	probably damaging	Het
Vps45	T	C	3: 96,041,445	T333A	probably benign	Het
Zbtb44	T	A	9: 31,054,243	D316E	probably damaging	Het
Zdhhc1	C	T	8: 105,483,558	V76M	probably benign	Het
Zfp235	T	C	7: 24,142,124	F656S	probably damaging	Het

Other mutations in Sstr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Sstr2	APN	11	113624995	missense	probably benign	0.22
IGL01555:Sstr2	APN	11	113625619	missense	probably benign	0.32
IGL02173:Sstr2	APN	11	113625016	missense	probably damaging	1.00
IGL02430:Sstr2	APN	11	113624804	missense	probably damaging	0.99
chat	UTSW	11	113624549	missense	probably damaging	1.00
R0125:Sstr2	UTSW	11	113624477	missense	probably damaging	1.00
R0565:Sstr2	UTSW	11	113625619	missense	probably benign	0.32
R1227:Sstr2	UTSW	11	113624885	missense	probably damaging	0.99
R1356:Sstr2	UTSW	11	113624894	missense	probably damaging	1.00
R1992:Sstr2	UTSW	11	113624669	missense	probably benign	0.03
R2504:Sstr2	UTSW	11	113624431	missense	probably damaging	0.98
R2509:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R2510:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R4051:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R4083:Sstr2	UTSW	11	113625245	missense	probably benign	0.05
R4207:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R4208:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R5666:Sstr2	UTSW	11	113624713	missense	probably damaging	1.00
R6264:Sstr2	UTSW	11	113625106	missense	probably damaging	1.00
R6339:Sstr2	UTSW	11	113624549	missense	probably damaging	1.00
R6443:Sstr2	UTSW	11	113625254	splice site	probably null
R6968:Sstr2	UTSW	11	113624948	missense	probably damaging	1.00
R7146:Sstr2	UTSW	11	113625353	missense	probably damaging	1.00
R7735:Sstr2	UTSW	11	113624597	missense	possibly damaging	0.75
R8057:Sstr2	UTSW	11	113624273	missense	probably benign
R8086:Sstr2	UTSW	11	113625172	missense	probably damaging	1.00
R8087:Sstr2	UTSW	11	113624675	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGACAGCCAAGATGATCAATG -3'
(R):5'- CAGCTGTTGGCATAGGTGAG -3'

Sequencing Primer
(F):5'- CCAAGATGATCAATGTAGCTGTGTG -3'
(R):5'- GTCAAACATGCCTTTCAGGG -3'

Posted On

2014-12-04