Mutagenetix > Incidental Mutations

Incidental Mutation 'R0312:Dock5'

25302

Institutional Source

Beutler Lab

Gene Symbol

Dock5

Ensembl Gene

ENSMUSG00000044447

Gene Name

dedicator of cytokinesis 5

Synonyms

lr2, 1110060D06Rik, rlc

MMRRC Submission

038522-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R0312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67752135-67933442 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 67795991 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 976 (F976L)

Ref Sequence

ENSEMBL: ENSMUSP00000036674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039135]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039135
AA Change: F976L

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: F976L

Domain	Start	End	E-Value	Type
SH3	11	68	1.45e-13	SMART
Pfam:DOCK_N	71	434	9e-110	PFAM
Pfam:DOCK-C2	439	636	1.1e-57	PFAM
low complexity region	752	764	N/A	INTRINSIC
Pfam:DHR-2	1133	1635	6.4e-99	PFAM
low complexity region	1663	1692	N/A	INTRINSIC
low complexity region	1815	1824	N/A	INTRINSIC

Meta Mutation Damage Score

0.1586

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.3%
20x: 90.3%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	T	10: 82,284,369	I4269N	probably damaging	Het
Abcb5	G	T	12: 118,872,837	A1113D	probably damaging	Het
Adcy1	G	T	11: 7,149,538	A673S	probably benign	Het
Apob	T	A	12: 8,009,034	H2505Q	probably benign	Het
Arhgap12	A	G	18: 6,061,982		probably benign	Het
Bcl9	C	T	3: 97,209,411	E656K	probably benign	Het
Bnc1	C	T	7: 81,977,324	R106H	possibly damaging	Het
Ccdc54	T	C	16: 50,590,802	K34E	possibly damaging	Het
Cfap65	G	A	1: 74,904,067	R1600W	probably damaging	Het
Csmd1	A	T	8: 15,984,760	N2470K	probably damaging	Het
Cspp1	T	C	1: 10,058,829		probably benign	Het
Dgkz	A	T	2: 91,938,339	I699N	probably damaging	Het
Dhx40	G	A	11: 86,771,949	T639I	probably damaging	Het
Dlg1	A	G	16: 31,790,267	T227A	probably benign	Het
Dnah10	G	A	5: 124,796,369		probably benign	Het
Dnah3	T	A	7: 120,045,659	K1133M	probably damaging	Het
Evc	C	T	5: 37,328,541	C97Y	possibly damaging	Het
Fbxw7	T	C	3: 84,967,569		probably benign	Het
Fggy	A	C	4: 95,844,185	D112A	probably damaging	Het
Fpgs	A	G	2: 32,684,801	Y435H	probably damaging	Het
Fryl	T	A	5: 73,072,888	H1642L	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gda	T	A	19: 21,417,005	I237F	probably damaging	Het
Glt1d1	A	G	5: 127,691,070	N247S	probably damaging	Het
Gm7647	T	C	5: 94,962,980	S7P	probably benign	Het
Gpr31b	C	T	17: 13,051,611	V224I	probably damaging	Het
Hlf	G	A	11: 90,387,875	P121L	possibly damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ism1	G	T	2: 139,678,672	M1I	probably null	Het
Kansl1l	T	C	1: 66,778,106	N365S	probably null	Het
Lama1	T	C	17: 67,775,851	L1368P	possibly damaging	Het
Lima1	A	G	15: 99,781,087	V491A	possibly damaging	Het
Lrch1	G	T	14: 74,947,594	H23N	possibly damaging	Het
Lrp1b	A	G	2: 41,282,171	V1488A	probably damaging	Het
Lrp8	T	C	4: 107,806,855		probably benign	Het
Lrrc8e	A	G	8: 4,235,733	S653G	probably benign	Het
Mnat1	A	G	12: 73,181,784	T141A	possibly damaging	Het
Mpeg1	C	A	19: 12,462,403	N408K	probably damaging	Het
Myo7b	T	C	18: 32,014,337	E51G	possibly damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naa35	A	G	13: 59,609,581	T257A	probably benign	Het
Obox5	T	A	7: 15,757,560	H8Q	probably damaging	Het
Olfr196	A	T	16: 59,167,839	F101L	probably benign	Het
Olfr350	A	T	2: 36,850,360	I105L	probably benign	Het
Olfr638	T	C	7: 104,004,025	V250A	probably damaging	Het
Phldb2	G	T	16: 45,789,047	T732N	probably damaging	Het
Phyhip	G	T	14: 70,466,970	A210S	possibly damaging	Het
Pik3r4	A	G	9: 105,686,210	D1262G	probably damaging	Het
Pip	G	A	6: 41,849,864	E48K	possibly damaging	Het
Plk4	C	T	3: 40,813,547	L74F	probably damaging	Het
Prdm14	G	A	1: 13,118,807	R438W	probably damaging	Het
Rab19	G	A	6: 39,384,089	R57H	probably benign	Het
Rtl1	G	T	12: 109,590,227	P1726Q	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Skint6	A	T	4: 112,809,100	V1176D	possibly damaging	Het
Slc12a1	A	G	2: 125,226,028	I1012V	probably damaging	Het
Slc1a3	C	T	15: 8,636,237	M509I	probably benign	Het
Spata18	G	A	5: 73,666,881	G35E	probably benign	Het
Sspo	C	T	6: 48,455,401	P801L	possibly damaging	Het
Ugt2b37	C	T	5: 87,250,665	G304D	probably damaging	Het
Vmn2r25	A	T	6: 123,828,580		probably benign	Het
Xrcc6	C	A	15: 82,027,222		probably null	Het

Other mutations in Dock5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Dock5	APN	14	67786889	splice site	probably benign
IGL00930:Dock5	APN	14	67771077	missense	probably damaging	1.00
IGL01525:Dock5	APN	14	67805720	splice site	probably benign
IGL01759:Dock5	APN	14	67881259	nonsense	probably null
IGL01941:Dock5	APN	14	67812232	missense	probably damaging	1.00
IGL02025:Dock5	APN	14	67763287	missense	probably damaging	1.00
IGL02093:Dock5	APN	14	67839543	splice site	probably benign
IGL02179:Dock5	APN	14	67806496	splice site	probably benign
IGL02208:Dock5	APN	14	67828450	missense	probably benign	0.06
IGL02605:Dock5	APN	14	67828438	missense	probably benign	0.18
IGL02608:Dock5	APN	14	67828439	missense	probably benign	0.01
IGL02938:Dock5	APN	14	67757218	splice site	probably benign
IGL02971:Dock5	APN	14	67757109	missense	probably null	1.00
IGL02983:Dock5	APN	14	67764670	missense	probably damaging	1.00
IGL03151:Dock5	APN	14	67866067	missense	probably damaging	1.00
IGL03410:Dock5	APN	14	67846086	missense	probably benign	0.04
PIT4366001:Dock5	UTSW	14	67824674	missense	possibly damaging	0.83
R0026:Dock5	UTSW	14	67846081	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0112:Dock5	UTSW	14	67819641	missense	probably benign
R0127:Dock5	UTSW	14	67846042	missense	probably benign	0.13
R0144:Dock5	UTSW	14	67786286	missense	probably benign	0.18
R0360:Dock5	UTSW	14	67822680	splice site	probably benign
R0364:Dock5	UTSW	14	67822680	splice site	probably benign
R0496:Dock5	UTSW	14	67817518	missense	probably damaging	1.00
R0506:Dock5	UTSW	14	67784792	splice site	probably benign
R0586:Dock5	UTSW	14	67809032	missense	probably damaging	1.00
R0597:Dock5	UTSW	14	67784934	splice site	probably null
R0625:Dock5	UTSW	14	67841163	missense	probably benign
R1109:Dock5	UTSW	14	67806478	missense	possibly damaging	0.80
R1221:Dock5	UTSW	14	67759161	missense	probably benign	0.00
R1278:Dock5	UTSW	14	67839566	missense	possibly damaging	0.80
R1927:Dock5	UTSW	14	67846062	missense	possibly damaging	0.60
R1944:Dock5	UTSW	14	67757135	nonsense	probably null
R1946:Dock5	UTSW	14	67786316	missense	probably damaging	1.00
R2046:Dock5	UTSW	14	67812142	missense	probably benign
R2101:Dock5	UTSW	14	67794010	missense	probably benign	0.02
R2252:Dock5	UTSW	14	67784812	missense	probably damaging	0.98
R2882:Dock5	UTSW	14	67839620	missense	probably damaging	0.99
R3110:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R3112:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R4236:Dock5	UTSW	14	67756492	missense	probably benign	0.02
R4242:Dock5	UTSW	14	67828490	missense	probably benign	0.19
R4244:Dock5	UTSW	14	67774582	missense	probably benign	0.41
R4646:Dock5	UTSW	14	67842779	missense	probably benign	0.01
R4793:Dock5	UTSW	14	67800354	missense	probably benign	0.26
R4841:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R4842:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R5159:Dock5	UTSW	14	67792289	missense	probably benign	0.04
R5164:Dock5	UTSW	14	67817661	nonsense	probably null
R5206:Dock5	UTSW	14	67763184	missense	probably benign	0.35
R5207:Dock5	UTSW	14	67776284	missense	probably benign	0.06
R5322:Dock5	UTSW	14	67770266	missense	probably benign	0.41
R5374:Dock5	UTSW	14	67805756	missense	possibly damaging	0.81
R5413:Dock5	UTSW	14	67764655	missense	probably damaging	1.00
R5476:Dock5	UTSW	14	67814007	missense	possibly damaging	0.92
R5504:Dock5	UTSW	14	67803086	missense	probably benign	0.01
R5677:Dock5	UTSW	14	67777603	missense	probably benign	0.00
R5773:Dock5	UTSW	14	67796058	missense	possibly damaging	0.95
R5845:Dock5	UTSW	14	67841101	missense	possibly damaging	0.82
R5957:Dock5	UTSW	14	67857994	missense	probably benign
R6154:Dock5	UTSW	14	67859912	missense	probably benign	0.03
R6268:Dock5	UTSW	14	67790275	nonsense	probably null
R6393:Dock5	UTSW	14	67822602	missense	probably benign	0.32
R6512:Dock5	UTSW	14	67824648	missense	possibly damaging	0.93
R6759:Dock5	UTSW	14	67795996	missense	probably benign	0.00
R7012:Dock5	UTSW	14	67822586	missense	probably damaging	1.00
R7061:Dock5	UTSW	14	67770254	missense	probably damaging	0.96
R7196:Dock5	UTSW	14	67756470	missense	probably damaging	1.00
R7200:Dock5	UTSW	14	67771702	nonsense	probably null
R7311:Dock5	UTSW	14	67828502	missense	probably benign	0.25
R7359:Dock5	UTSW	14	67765888	missense	probably benign	0.10
R7422:Dock5	UTSW	14	67809030	missense	probably benign	0.01
R7588:Dock5	UTSW	14	67763158	critical splice donor site	probably null
R7637:Dock5	UTSW	14	67786340	missense	possibly damaging	0.95
R7709:Dock5	UTSW	14	67796005	missense	probably benign	0.44
R7763:Dock5	UTSW	14	67821327	missense	probably damaging	0.97
R8044:Dock5	UTSW	14	67824692	missense	probably damaging	1.00
R8076:Dock5	UTSW	14	67802977	splice site	probably null
R8168:Dock5	UTSW	14	67770197	splice site	probably null
R8353:Dock5	UTSW	14	67817508	splice site	probably null
R8480:Dock5	UTSW	14	67836410	missense	probably benign	0.32
R8535:Dock5	UTSW	14	67793976	missense	probably benign	0.19
R8708:Dock5	UTSW	14	67767371	missense	probably benign	0.02
R8732:Dock5	UTSW	14	67846000	missense	possibly damaging	0.85
R8888:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8895:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8936:Dock5	UTSW	14	67845990	nonsense	probably null
R8962:Dock5	UTSW	14	67757191	missense	probably benign
X0023:Dock5	UTSW	14	67771088	missense	probably benign	0.15
Z1177:Dock5	UTSW	14	67813933	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TGTGCTCAGGCAATGAAGCAGG -3'
(R):5'- GGTAGAAAGCCCCAACTCCATGATG -3'

Sequencing Primer
(F):5'- Aacacacacacacacacacac -3'
(R):5'- TGATGCCCAAAGTCTCCTAGC -3'

Posted On

2013-04-16