Incidental Mutation 'R0312:Dock5'
ID25302
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Namededicator of cytokinesis 5
Synonymslr2, 1110060D06Rik, rlc
MMRRC Submission 038522-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R0312 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location67752135-67933442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 67795991 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 976 (F976L)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039135
AA Change: F976L

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: F976L

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Meta Mutation Damage Score 0.1586 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Abcb5 G T 12: 118,872,837 A1113D probably damaging Het
Adcy1 G T 11: 7,149,538 A673S probably benign Het
Apob T A 12: 8,009,034 H2505Q probably benign Het
Arhgap12 A G 18: 6,061,982 probably benign Het
Bcl9 C T 3: 97,209,411 E656K probably benign Het
Bnc1 C T 7: 81,977,324 R106H possibly damaging Het
Ccdc54 T C 16: 50,590,802 K34E possibly damaging Het
Cfap65 G A 1: 74,904,067 R1600W probably damaging Het
Csmd1 A T 8: 15,984,760 N2470K probably damaging Het
Cspp1 T C 1: 10,058,829 probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dhx40 G A 11: 86,771,949 T639I probably damaging Het
Dlg1 A G 16: 31,790,267 T227A probably benign Het
Dnah10 G A 5: 124,796,369 probably benign Het
Dnah3 T A 7: 120,045,659 K1133M probably damaging Het
Evc C T 5: 37,328,541 C97Y possibly damaging Het
Fbxw7 T C 3: 84,967,569 probably benign Het
Fggy A C 4: 95,844,185 D112A probably damaging Het
Fpgs A G 2: 32,684,801 Y435H probably damaging Het
Fryl T A 5: 73,072,888 H1642L probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gda T A 19: 21,417,005 I237F probably damaging Het
Glt1d1 A G 5: 127,691,070 N247S probably damaging Het
Gm7647 T C 5: 94,962,980 S7P probably benign Het
Gpr31b C T 17: 13,051,611 V224I probably damaging Het
Hlf G A 11: 90,387,875 P121L possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ism1 G T 2: 139,678,672 M1I probably null Het
Kansl1l T C 1: 66,778,106 N365S probably null Het
Lama1 T C 17: 67,775,851 L1368P possibly damaging Het
Lima1 A G 15: 99,781,087 V491A possibly damaging Het
Lrch1 G T 14: 74,947,594 H23N possibly damaging Het
Lrp1b A G 2: 41,282,171 V1488A probably damaging Het
Lrp8 T C 4: 107,806,855 probably benign Het
Lrrc8e A G 8: 4,235,733 S653G probably benign Het
Mnat1 A G 12: 73,181,784 T141A possibly damaging Het
Mpeg1 C A 19: 12,462,403 N408K probably damaging Het
Myo7b T C 18: 32,014,337 E51G possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naa35 A G 13: 59,609,581 T257A probably benign Het
Obox5 T A 7: 15,757,560 H8Q probably damaging Het
Olfr196 A T 16: 59,167,839 F101L probably benign Het
Olfr350 A T 2: 36,850,360 I105L probably benign Het
Olfr638 T C 7: 104,004,025 V250A probably damaging Het
Phldb2 G T 16: 45,789,047 T732N probably damaging Het
Phyhip G T 14: 70,466,970 A210S possibly damaging Het
Pik3r4 A G 9: 105,686,210 D1262G probably damaging Het
Pip G A 6: 41,849,864 E48K possibly damaging Het
Plk4 C T 3: 40,813,547 L74F probably damaging Het
Prdm14 G A 1: 13,118,807 R438W probably damaging Het
Rab19 G A 6: 39,384,089 R57H probably benign Het
Rtl1 G T 12: 109,590,227 P1726Q probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skint6 A T 4: 112,809,100 V1176D possibly damaging Het
Slc12a1 A G 2: 125,226,028 I1012V probably damaging Het
Slc1a3 C T 15: 8,636,237 M509I probably benign Het
Spata18 G A 5: 73,666,881 G35E probably benign Het
Sspo C T 6: 48,455,401 P801L possibly damaging Het
Ugt2b37 C T 5: 87,250,665 G304D probably damaging Het
Vmn2r25 A T 6: 123,828,580 probably benign Het
Xrcc6 C A 15: 82,027,222 probably null Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTGCTCAGGCAATGAAGCAGG -3'
(R):5'- GGTAGAAAGCCCCAACTCCATGATG -3'

Sequencing Primer
(F):5'- Aacacacacacacacacacac -3'
(R):5'- TGATGCCCAAAGTCTCCTAGC -3'
Posted On2013-04-16