Mutagenetix > Incidental Mutation

Incidental Mutation 'R0313:Dnah7b'

25303

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

LOC227058, Dnahc7b

MMRRC Submission

038523-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R0313 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46105475-46412710 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46246803 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1660 (T1660A)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069293
AA Change: T1660A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: T1660A

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Meta Mutation Damage Score

0.4859

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.9%
20x: 88.5%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	A	G	6: 58,649,082 (GRCm39)	E309G	probably benign	Het
Ankmy1	C	T	1: 92,813,943 (GRCm39)	G412D	probably damaging	Het
Cc2d1a	G	A	8: 84,863,598 (GRCm39)	T542I	probably benign	Het
Cldn18	T	C	9: 99,580,967 (GRCm39)	I94V	probably benign	Het
Cobll1	G	A	2: 64,926,088 (GRCm39)	R1195*	probably null	Het
Dzip3	G	T	16: 48,757,424 (GRCm39)	Q870K	probably damaging	Het
Ebf4	T	C	2: 130,148,707 (GRCm39)		probably benign	Het
Ecpas	A	G	4: 58,811,892 (GRCm39)	I1411T	probably benign	Het
Esyt2	T	C	12: 116,311,428 (GRCm39)	L439P	probably damaging	Het
Fbxl17	G	A	17: 63,663,846 (GRCm39)	R67C	probably damaging	Het
Haspin	A	G	11: 73,027,124 (GRCm39)	V655A	probably damaging	Het
Kmt2c	T	C	5: 25,549,928 (GRCm39)	E1351G	probably damaging	Het
Lama2	C	A	10: 26,869,394 (GRCm39)		probably null	Het
Lcp1	A	G	14: 75,436,873 (GRCm39)	E73G	probably damaging	Het
Ltv1	C	T	10: 13,058,604 (GRCm39)		probably null	Het
Mcmdc2	A	G	1: 10,002,366 (GRCm39)	Y529C	probably damaging	Het
Myo3b	T	A	2: 70,179,303 (GRCm39)	Y1172*	probably null	Het
Ncf1	T	C	5: 134,258,421 (GRCm39)	M1V	probably null	Het
Or4k47	C	T	2: 111,451,945 (GRCm39)	S158N	possibly damaging	Het
Or6c8b	A	G	10: 128,882,695 (GRCm39)	V79A	possibly damaging	Het
Or8c10	T	C	9: 38,279,600 (GRCm39)	S243P	probably damaging	Het
Pcif1	A	T	2: 164,726,339 (GRCm39)	H80L	probably damaging	Het
Pclo	T	C	5: 14,728,887 (GRCm39)		probably benign	Het
Polr2a	T	C	11: 69,625,906 (GRCm39)	Y1710C	unknown	Het
Ppp1r37	G	A	7: 19,267,923 (GRCm39)	T324I	probably damaging	Het
Prmt1	T	C	7: 44,628,172 (GRCm39)	D176G	probably benign	Het
Scn5a	T	C	9: 119,363,637 (GRCm39)	D501G	probably damaging	Het
Ska2	A	G	11: 87,008,640 (GRCm39)	I89M	possibly damaging	Het
Slc39a7	G	A	17: 34,248,518 (GRCm39)	A375V	probably damaging	Het
Ssrp1	T	A	2: 84,871,898 (GRCm39)	I374N	probably damaging	Het
Stox2	C	T	8: 47,645,169 (GRCm39)	G828R	probably damaging	Het
Tcam1	G	A	11: 106,174,904 (GRCm39)	E120K	probably benign	Het
Uqcrc1	C	A	9: 108,777,642 (GRCm39)	R114S	possibly damaging	Het
Usp38	A	T	8: 81,711,071 (GRCm39)	L988*	probably null	Het
Vmn2r5	T	A	3: 64,411,248 (GRCm39)	H440L	probably benign	Het
Wdr12	A	T	1: 60,121,738 (GRCm39)	I271N	possibly damaging	Het
Xylt2	C	T	11: 94,560,720 (GRCm39)		probably benign	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46,181,309 (GRCm39)	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46,250,497 (GRCm39)	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46,263,811 (GRCm39)	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46,105,889 (GRCm39)	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46,253,482 (GRCm39)	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46,234,538 (GRCm39)	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46,120,592 (GRCm39)	splice site	probably benign
IGL01392:Dnah7b	APN	1	46,165,948 (GRCm39)	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46,155,460 (GRCm39)	splice site	probably benign
IGL01460:Dnah7b	APN	1	46,178,864 (GRCm39)	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46,307,813 (GRCm39)	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46,397,307 (GRCm39)	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46,397,297 (GRCm39)	nonsense	probably null
IGL01906:Dnah7b	APN	1	46,214,613 (GRCm39)	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46,163,497 (GRCm39)	splice site	probably benign
IGL01989:Dnah7b	APN	1	46,328,694 (GRCm39)	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46,179,035 (GRCm39)	missense	probably benign
IGL02213:Dnah7b	APN	1	46,272,752 (GRCm39)	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46,266,090 (GRCm39)	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46,138,663 (GRCm39)	nonsense	probably null
IGL02381:Dnah7b	APN	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46,273,353 (GRCm39)	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46,234,478 (GRCm39)	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46,162,937 (GRCm39)	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46,155,461 (GRCm39)	splice site	probably benign
IGL02704:Dnah7b	APN	1	46,181,293 (GRCm39)	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46,138,768 (GRCm39)	splice site	probably benign
IGL02745:Dnah7b	APN	1	46,234,189 (GRCm39)	splice site	probably benign
IGL02818:Dnah7b	APN	1	46,329,968 (GRCm39)	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46,158,458 (GRCm39)	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46,221,535 (GRCm39)	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46,124,849 (GRCm39)	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46,158,464 (GRCm39)	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46,412,508 (GRCm39)	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46,252,520 (GRCm39)	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46,262,338 (GRCm39)	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46,258,508 (GRCm39)	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46,162,937 (GRCm39)	missense	probably benign	0.26
R0317:Dnah7b	UTSW	1	46,173,816 (GRCm39)	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46,280,104 (GRCm39)	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46,316,286 (GRCm39)	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46,275,948 (GRCm39)	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46,179,336 (GRCm39)	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46,258,704 (GRCm39)	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46,280,152 (GRCm39)	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46,379,292 (GRCm39)	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46,138,772 (GRCm39)	splice site	probably benign
R1035:Dnah7b	UTSW	1	46,163,608 (GRCm39)	missense	probably benign
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46,364,970 (GRCm39)	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46,379,280 (GRCm39)	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46,138,669 (GRCm39)	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46,328,816 (GRCm39)	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46,117,753 (GRCm39)	splice site	probably benign
R1484:Dnah7b	UTSW	1	46,176,703 (GRCm39)	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46,216,441 (GRCm39)	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46,105,957 (GRCm39)	missense	unknown
R1607:Dnah7b	UTSW	1	46,329,806 (GRCm39)	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46,392,126 (GRCm39)	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46,214,550 (GRCm39)	nonsense	probably null
R1681:Dnah7b	UTSW	1	46,363,872 (GRCm39)	nonsense	probably null
R1716:Dnah7b	UTSW	1	46,230,943 (GRCm39)	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46,272,919 (GRCm39)	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46,316,265 (GRCm39)	missense	probably damaging	1.00
R1838:Dnah7b	UTSW	1	46,155,337 (GRCm39)	missense	probably benign	0.04
R1898:Dnah7b	UTSW	1	46,275,874 (GRCm39)	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46,281,263 (GRCm39)	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46,181,247 (GRCm39)	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46,281,481 (GRCm39)	nonsense	probably null
R2083:Dnah7b	UTSW	1	46,280,227 (GRCm39)	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46,137,152 (GRCm39)	splice site	probably benign
R2172:Dnah7b	UTSW	1	46,163,672 (GRCm39)	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46,240,344 (GRCm39)	splice site	probably benign
R2247:Dnah7b	UTSW	1	46,316,223 (GRCm39)	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46,273,075 (GRCm39)	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46,402,114 (GRCm39)	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46,234,447 (GRCm39)	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46,178,901 (GRCm39)	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46,246,732 (GRCm39)	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46,227,847 (GRCm39)	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46,221,583 (GRCm39)	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46,307,869 (GRCm39)	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46,392,033 (GRCm39)	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46,339,035 (GRCm39)	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46,282,417 (GRCm39)	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46,176,645 (GRCm39)	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46,272,871 (GRCm39)	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46,120,655 (GRCm39)	missense	probably benign
R4172:Dnah7b	UTSW	1	46,266,106 (GRCm39)	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46,176,578 (GRCm39)	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46,260,932 (GRCm39)	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
R4414:Dnah7b	UTSW	1	46,165,840 (GRCm39)	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46,124,792 (GRCm39)	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46,328,696 (GRCm39)	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46,117,684 (GRCm39)	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46,256,317 (GRCm39)	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46,250,488 (GRCm39)	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46,246,816 (GRCm39)	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46,106,115 (GRCm39)	missense	unknown
R4780:Dnah7b	UTSW	1	46,392,174 (GRCm39)	missense	probably benign
R4828:Dnah7b	UTSW	1	46,167,272 (GRCm39)	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46,395,762 (GRCm39)	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46,234,234 (GRCm39)	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46,120,604 (GRCm39)	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46,240,478 (GRCm39)	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46,329,935 (GRCm39)	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46,272,886 (GRCm39)	missense	probably benign
R5000:Dnah7b	UTSW	1	46,138,663 (GRCm39)	nonsense	probably null
R5005:Dnah7b	UTSW	1	46,281,188 (GRCm39)	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46,226,523 (GRCm39)	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46,221,540 (GRCm39)	nonsense	probably null
R5174:Dnah7b	UTSW	1	46,282,509 (GRCm39)	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46,397,376 (GRCm39)	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46,273,018 (GRCm39)	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46,412,514 (GRCm39)	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46,272,849 (GRCm39)	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46,256,351 (GRCm39)	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46,227,819 (GRCm39)	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46,397,431 (GRCm39)	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46,281,366 (GRCm39)	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46,281,179 (GRCm39)	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46,148,472 (GRCm39)	missense	probably null
R5479:Dnah7b	UTSW	1	46,262,265 (GRCm39)	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46,281,359 (GRCm39)	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46,395,674 (GRCm39)	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46,307,924 (GRCm39)	splice site	probably null
R5659:Dnah7b	UTSW	1	46,392,009 (GRCm39)	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46,273,152 (GRCm39)	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46,181,292 (GRCm39)	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46,230,885 (GRCm39)	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46,376,753 (GRCm39)	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46,260,803 (GRCm39)	missense	probably benign
R5941:Dnah7b	UTSW	1	46,226,450 (GRCm39)	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46,402,147 (GRCm39)	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46,158,558 (GRCm39)	splice site	probably null
R6041:Dnah7b	UTSW	1	46,328,805 (GRCm39)	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46,178,949 (GRCm39)	missense	probably benign
R6049:Dnah7b	UTSW	1	46,124,762 (GRCm39)	missense	probably benign
R6131:Dnah7b	UTSW	1	46,292,626 (GRCm39)	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46,329,863 (GRCm39)	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46,272,745 (GRCm39)	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46,165,828 (GRCm39)	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46,265,048 (GRCm39)	missense	probably benign
R6273:Dnah7b	UTSW	1	46,281,476 (GRCm39)	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46,379,335 (GRCm39)	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46,281,364 (GRCm39)	nonsense	probably null
R6494:Dnah7b	UTSW	1	46,138,591 (GRCm39)	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46,263,902 (GRCm39)	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46,379,377 (GRCm39)	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46,230,948 (GRCm39)	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46,234,280 (GRCm39)	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46,158,428 (GRCm39)	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46,397,398 (GRCm39)	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46,234,299 (GRCm39)	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46,275,969 (GRCm39)	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46,391,973 (GRCm39)	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46,178,870 (GRCm39)	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46,281,302 (GRCm39)	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46,179,126 (GRCm39)	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46,122,914 (GRCm39)	missense	probably benign
R7244:Dnah7b	UTSW	1	46,316,303 (GRCm39)	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46,181,245 (GRCm39)	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46,234,532 (GRCm39)	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46,342,794 (GRCm39)	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46,214,579 (GRCm39)	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46,329,894 (GRCm39)	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46,364,925 (GRCm39)	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46,395,714 (GRCm39)	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46,163,506 (GRCm39)	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46,253,573 (GRCm39)	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46,307,794 (GRCm39)	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46,148,462 (GRCm39)	missense	probably benign
R7676:Dnah7b	UTSW	1	46,273,324 (GRCm39)	nonsense	probably null
R7731:Dnah7b	UTSW	1	46,178,905 (GRCm39)	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46,240,413 (GRCm39)	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46,176,634 (GRCm39)	missense	probably benign
R7807:Dnah7b	UTSW	1	46,253,527 (GRCm39)	missense	probably benign
R7895:Dnah7b	UTSW	1	46,289,110 (GRCm39)	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46,178,838 (GRCm39)	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46,266,163 (GRCm39)	missense	probably benign
R7946:Dnah7b	UTSW	1	46,272,739 (GRCm39)	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46,282,584 (GRCm39)	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46,282,525 (GRCm39)	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46,263,866 (GRCm39)	nonsense	probably null
R8094:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46,272,913 (GRCm39)	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46,292,671 (GRCm39)	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46,395,736 (GRCm39)	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46,179,032 (GRCm39)	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46,214,456 (GRCm39)	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46,395,819 (GRCm39)	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46,227,839 (GRCm39)	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46,329,875 (GRCm39)	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46,138,650 (GRCm39)	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46,155,360 (GRCm39)	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46,214,598 (GRCm39)	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46,221,624 (GRCm39)	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46,392,159 (GRCm39)	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46,162,806 (GRCm39)	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46,273,305 (GRCm39)	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46,230,953 (GRCm39)	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46,280,236 (GRCm39)	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46,292,534 (GRCm39)	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46,262,232 (GRCm39)	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46,282,575 (GRCm39)	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46,173,674 (GRCm39)	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46,266,180 (GRCm39)	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46,181,194 (GRCm39)	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46,330,038 (GRCm39)	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46,361,420 (GRCm39)	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46,272,914 (GRCm39)	nonsense	probably null
R9392:Dnah7b	UTSW	1	46,162,898 (GRCm39)	nonsense	probably null
R9456:Dnah7b	UTSW	1	46,165,953 (GRCm39)	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46,253,564 (GRCm39)	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46,264,956 (GRCm39)	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46,292,621 (GRCm39)	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46,252,544 (GRCm39)	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
RF020:Dnah7b	UTSW	1	46,412,421 (GRCm39)	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46,412,458 (GRCm39)	nonsense	probably null
X0023:Dnah7b	UTSW	1	46,342,737 (GRCm39)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CGCACCTTTTATCAGGGAATTACCTCA -3'
(R):5'- GGACTCATTGCTTGTTTGATTTTGCCAT -3'

Sequencing Primer
(F):5'- TTACAATGAACTGCTGGCCG -3'
(R):5'- CAGAAACACCTGTAACCTTTCTGA -3'

Posted On

2013-04-16