Incidental Mutation 'R2511:Krt7'
ID253030
Institutional Source Beutler Lab
Gene Symbol Krt7
Ensembl Gene ENSMUSG00000023039
Gene Namekeratin 7
SynonymsCytokeratin 7, D15Wsu77e, Krt2-7, K7
MMRRC Submission 040417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2511 (G1)
Quality Score206
Status Not validated
Chromosome15
Chromosomal Location101411043-101430313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101412657 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 62 (I62L)
Ref Sequence ENSEMBL: ENSMUSP00000069900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068904] [ENSMUST00000147662]
Predicted Effect probably benign
Transcript: ENSMUST00000068904
AA Change: I62L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000069900
Gene: ENSMUSG00000023039
AA Change: I62L

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Pfam:Keratin_2_head 43 81 3.2e-12 PFAM
Filament 84 396 1.95e-174 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141190
Predicted Effect probably benign
Transcript: ENSMUST00000147662
SMART Domains Protein: ENSMUSP00000117046
Gene: ENSMUSG00000023039

DomainStartEndE-ValueType
Pfam:Filament 1 115 4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231016
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation of urothelial cells without histological evidence of hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
9330159F19Rik T A 10: 29,221,906 C100S probably damaging Het
Abcc8 C T 7: 46,150,780 R526H probably damaging Het
Acad10 G A 5: 121,631,567 P609S probably benign Het
Acod1 A T 14: 103,051,339 D95V probably damaging Het
Acsm5 A T 7: 119,530,454 I130F possibly damaging Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ankar A T 1: 72,658,694 I791K probably damaging Het
Ano10 A G 9: 122,258,945 V364A probably damaging Het
Arhgap9 T C 10: 127,328,985 probably null Het
Arsi G A 18: 60,916,594 C183Y probably damaging Het
Ascl2 T G 7: 142,968,216 E97A probably damaging Het
Asna1 A G 8: 85,019,766 V151A possibly damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bms1 C T 6: 118,391,153 probably null Het
Bysl T A 17: 47,604,335 T163S probably benign Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cc2d2a A T 5: 43,735,395 Q1433L probably damaging Het
Cchcr1 T C 17: 35,530,513 S809P probably benign Het
Ccz1 G T 5: 144,012,997 T70K probably damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cep164 A T 9: 45,775,249 L729Q probably damaging Het
Clcn6 A G 4: 148,017,494 probably null Het
Clcn7 T A 17: 25,155,446 V507E probably damaging Het
Ctso A C 3: 81,932,734 T24P probably damaging Het
Dis3l2 A T 1: 86,990,258 N543I probably benign Het
Dnah12 A T 14: 26,769,950 Y1114F possibly damaging Het
Emx1 A G 6: 85,204,051 D250G probably benign Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Fam149b A C 14: 20,378,456 N341T probably damaging Het
Fsip2 A G 2: 82,951,657 K62R probably damaging Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
Gbp3 A G 3: 142,570,582 R480G probably benign Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm9930 T C 10: 9,534,702 noncoding transcript Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Gzmg A T 14: 56,158,375 D42E probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Hs2st1 G A 3: 144,569,930 probably benign Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Irf1 T C 11: 53,773,791 V108A probably damaging Het
Jsrp1 C G 10: 80,812,306 S36T probably benign Het
Kcnq5 T A 1: 21,505,782 R233* probably null Het
Kif7 T C 7: 79,702,264 K917E probably damaging Het
Lifr A G 15: 7,166,916 T194A probably benign Het
Ltbp2 T C 12: 84,804,409 probably null Het
Man2c1 A G 9: 57,141,388 probably null Het
Met T C 6: 17,491,967 S243P probably damaging Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mre11a A C 9: 14,795,769 probably null Het
Mroh9 A G 1: 163,038,945 S710P probably benign Het
Mvk C A 5: 114,450,398 Y116* probably null Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncf1 T C 5: 134,225,698 D184G probably damaging Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1137 T C 2: 87,711,048 N286S probably damaging Het
Olfr1301 T A 2: 111,754,316 N22K probably benign Het
Olfr1449 T A 19: 12,935,173 M145K possibly damaging Het
Olfr690 A T 7: 105,329,610 I194N probably damaging Het
Olfr700 G T 7: 106,805,961 P167H probably damaging Het
Pcdh1 G A 18: 38,199,479 T296M possibly damaging Het
Pcdh15 A G 10: 74,645,996 D391G possibly damaging Het
Pcdha7 C A 18: 36,974,733 D270E probably damaging Het
Pgam1 C A 19: 41,915,876 S137R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plce1 T G 19: 38,760,054 I1729S probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Prkce T A 17: 86,625,326 I578N probably damaging Het
Prss58 A C 6: 40,897,800 S36A probably damaging Het
Ptprm T C 17: 66,693,778 H1128R probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rubcn T C 16: 32,847,254 N179S probably damaging Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Sh3bp5 G A 14: 31,411,629 T82M probably damaging Het
Shank2 A G 7: 144,411,577 Y974C probably damaging Het
Slc9c1 T C 16: 45,544,736 I144T possibly damaging Het
Slf2 T C 19: 44,941,606 I374T possibly damaging Het
Snx13 A G 12: 35,138,081 D786G probably benign Het
Spcs3 A G 8: 54,523,354 V151A possibly damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stac3 T C 10: 127,503,918 probably null Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgm5 T C 2: 121,076,948 E98G possibly damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tmem94 G A 11: 115,791,961 R608H probably damaging Het
Tnrc6a G A 7: 123,171,092 V702I probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim24 G A 6: 37,903,652 probably null Het
Ugt1a2 A G 1: 88,201,124 Y163C probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn2r50 T A 7: 10,047,713 E368D possibly damaging Het
Vmn2r59 T C 7: 42,043,766 N470S probably damaging Het
Vps45 T C 3: 96,041,445 T333A probably benign Het
Zbtb44 T A 9: 31,054,243 D316E probably damaging Het
Zdhhc1 C T 8: 105,483,558 V76M probably benign Het
Zfp235 T C 7: 24,142,124 F656S probably damaging Het
Other mutations in Krt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Krt7 APN 15 101427085 unclassified probably benign
IGL01025:Krt7 APN 15 101423421 missense probably benign 0.17
IGL02229:Krt7 APN 15 101427616 missense probably benign 0.09
IGL03366:Krt7 APN 15 101427610 missense possibly damaging 0.87
R0256:Krt7 UTSW 15 101423309 nonsense probably null
R1648:Krt7 UTSW 15 101412567 missense probably damaging 1.00
R1696:Krt7 UTSW 15 101423426 missense probably benign 0.01
R1779:Krt7 UTSW 15 101423409 missense probably damaging 1.00
R1837:Krt7 UTSW 15 101419582 missense probably benign 0.42
R2045:Krt7 UTSW 15 101423484 unclassified probably null
R2510:Krt7 UTSW 15 101412657 missense probably benign 0.01
R4041:Krt7 UTSW 15 101423280 unclassified probably null
R4729:Krt7 UTSW 15 101420558 missense probably benign 0.03
R4964:Krt7 UTSW 15 101413972 missense probably damaging 1.00
R5032:Krt7 UTSW 15 101412547 missense probably benign 0.00
R6023:Krt7 UTSW 15 101412397 intron probably benign
R6270:Krt7 UTSW 15 101419558 missense probably damaging 1.00
R7019:Krt7 UTSW 15 101413970 missense probably damaging 1.00
R7645:Krt7 UTSW 15 101412643 missense probably damaging 1.00
R7773:Krt7 UTSW 15 101414032 missense possibly damaging 0.49
R7844:Krt7 UTSW 15 101412634 missense possibly damaging 0.80
R7927:Krt7 UTSW 15 101412634 missense possibly damaging 0.80
X0026:Krt7 UTSW 15 101412772 missense probably damaging 0.98
Z1177:Krt7 UTSW 15 101423467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGCCGCTATGTCCATC -3'
(R):5'- CATTTGTTGGCAGAGCGGAG -3'

Sequencing Primer
(F):5'- GCTATGTCCATCCACTTCAGC -3'
(R):5'- GGAGAAGTACTATACAGAGCCCAC -3'
Posted On2014-12-04