Incidental Mutation 'R2511:Slc9c1'
ID 253034
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 040417-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R2511 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45365099 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 144 (I144T)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: I144T

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: I144T

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162151
AA Change: I115T
Predicted Effect unknown
Transcript: ENSMUST00000162774
AA Change: I115T
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,097,902 (GRCm39) C100S probably damaging Het
Abcc8 C T 7: 45,800,204 (GRCm39) R526H probably damaging Het
Acad10 G A 5: 121,769,630 (GRCm39) P609S probably benign Het
Acod1 A T 14: 103,288,775 (GRCm39) D95V probably damaging Het
Acsm5 A T 7: 119,129,677 (GRCm39) I130F possibly damaging Het
Ago4 A T 4: 126,410,864 (GRCm39) D208E probably damaging Het
Agrn A T 4: 156,250,881 (GRCm39) probably null Het
Ankar A T 1: 72,697,853 (GRCm39) I791K probably damaging Het
Ano10 A G 9: 122,088,011 (GRCm39) V364A probably damaging Het
Arhgap9 T C 10: 127,164,854 (GRCm39) probably null Het
Arsi G A 18: 61,049,666 (GRCm39) C183Y probably damaging Het
Ascl2 T G 7: 142,521,953 (GRCm39) E97A probably damaging Het
Bcl2a1a C T 9: 88,839,506 (GRCm39) R135W probably damaging Het
Bms1 C T 6: 118,368,114 (GRCm39) probably null Het
Bysl T A 17: 47,915,260 (GRCm39) T163S probably benign Het
Card10 A G 15: 78,664,473 (GRCm39) I821T probably benign Het
Cc2d2a A T 5: 43,892,737 (GRCm39) Q1433L probably damaging Het
Cchcr1 T C 17: 35,841,410 (GRCm39) S809P probably benign Het
Ccz1 G T 5: 143,949,815 (GRCm39) T70K probably damaging Het
Cdc25c G C 18: 34,871,292 (GRCm39) L275V probably damaging Het
Cep164 A T 9: 45,686,547 (GRCm39) L729Q probably damaging Het
Clcn6 A G 4: 148,101,951 (GRCm39) probably null Het
Clcn7 T A 17: 25,374,420 (GRCm39) V507E probably damaging Het
Cracdl T C 1: 37,664,381 (GRCm39) M506V probably benign Het
Ctso A C 3: 81,840,041 (GRCm39) T24P probably damaging Het
Dis3l2 A T 1: 86,917,980 (GRCm39) N543I probably benign Het
Dnah12 A T 14: 26,491,907 (GRCm39) Y1114F possibly damaging Het
Emx1 A G 6: 85,181,033 (GRCm39) D250G probably benign Het
Epha4 G A 1: 77,488,339 (GRCm39) A47V possibly damaging Het
Fam149b A C 14: 20,428,524 (GRCm39) N341T probably damaging Het
Fsip2 A G 2: 82,782,001 (GRCm39) K62R probably damaging Het
Fsip2 T C 2: 82,816,782 (GRCm39) S4172P probably benign Het
Gbp3 A G 3: 142,276,343 (GRCm39) R480G probably benign Het
Get3 A G 8: 85,746,395 (GRCm39) V151A possibly damaging Het
Gja8 T G 3: 96,827,033 (GRCm39) T210P probably damaging Het
Gm5431 T A 11: 48,779,536 (GRCm39) N740I probably benign Het
Gm9930 T C 10: 9,410,446 (GRCm39) noncoding transcript Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Gzmg A T 14: 56,395,832 (GRCm39) D42E probably benign Het
Hoxd12 G A 2: 74,505,815 (GRCm39) A129T possibly damaging Het
Hs2st1 G A 3: 144,275,691 (GRCm39) probably benign Het
Ifnlr1 G T 4: 135,432,559 (GRCm39) D332Y probably damaging Het
Igsf10 T C 3: 59,239,287 (GRCm39) D298G probably damaging Het
Irf1 T C 11: 53,664,617 (GRCm39) V108A probably damaging Het
Jsrp1 C G 10: 80,648,140 (GRCm39) S36T probably benign Het
Kcnq5 T A 1: 21,576,006 (GRCm39) R233* probably null Het
Kif7 T C 7: 79,352,012 (GRCm39) K917E probably damaging Het
Krt7 A C 15: 101,310,538 (GRCm39) I62L probably benign Het
Lifr A G 15: 7,196,397 (GRCm39) T194A probably benign Het
Ltbp2 T C 12: 84,851,183 (GRCm39) probably null Het
Maco1 A G 4: 134,531,699 (GRCm39) S657P probably damaging Het
Man2c1 A G 9: 57,048,672 (GRCm39) probably null Het
Met T C 6: 17,491,966 (GRCm39) S243P probably damaging Het
Mllt10 C A 2: 18,069,935 (GRCm39) D30E possibly damaging Het
Mre11a A C 9: 14,707,065 (GRCm39) probably null Het
Mroh9 A G 1: 162,866,514 (GRCm39) S710P probably benign Het
Mvk C A 5: 114,588,459 (GRCm39) Y116* probably null Het
Myh1 A G 11: 67,096,423 (GRCm39) I301V probably benign Het
Ncf1 T C 5: 134,254,552 (GRCm39) D184G probably damaging Het
Nxpe4 T C 9: 48,304,533 (GRCm39) F207L probably damaging Het
Or2ag18 G T 7: 106,405,168 (GRCm39) P167H probably damaging Het
Or2y1b T G 11: 49,209,048 (GRCm39) L225R probably damaging Het
Or4k51 T A 2: 111,584,661 (GRCm39) N22K probably benign Het
Or52b1 A T 7: 104,978,817 (GRCm39) I194N probably damaging Het
Or5b24 T A 19: 12,912,537 (GRCm39) M145K possibly damaging Het
Or5w14 T C 2: 87,541,392 (GRCm39) N286S probably damaging Het
Pcdh1 G A 18: 38,332,532 (GRCm39) T296M possibly damaging Het
Pcdh15 A G 10: 74,481,828 (GRCm39) D391G possibly damaging Het
Pcdha7 C A 18: 37,107,786 (GRCm39) D270E probably damaging Het
Pgam1 C A 19: 41,904,315 (GRCm39) S137R probably damaging Het
Pitpnm2 T C 5: 124,274,389 (GRCm39) E240G probably damaging Het
Plce1 T G 19: 38,748,498 (GRCm39) I1729S probably damaging Het
Plppr4 G T 3: 117,125,355 (GRCm39) N161K probably damaging Het
Pramel27 G A 4: 143,578,561 (GRCm39) V274I probably benign Het
Prkce T A 17: 86,932,754 (GRCm39) I578N probably damaging Het
Prss58 A C 6: 40,874,734 (GRCm39) S36A probably damaging Het
Ptprm T C 17: 67,000,773 (GRCm39) H1128R probably damaging Het
Rgs9 T C 11: 109,159,798 (GRCm39) Y178C probably benign Het
Rubcn T C 16: 32,667,624 (GRCm39) N179S probably damaging Het
Sh3bp1 C T 15: 78,795,706 (GRCm39) P612S probably damaging Het
Sh3bp5 G A 14: 31,133,586 (GRCm39) T82M probably damaging Het
Shank2 A G 7: 143,965,314 (GRCm39) Y974C probably damaging Het
Slf2 T C 19: 44,930,045 (GRCm39) I374T possibly damaging Het
Snx13 A G 12: 35,188,080 (GRCm39) D786G probably benign Het
Spcs3 A G 8: 54,976,389 (GRCm39) V151A possibly damaging Het
Sstr2 A T 11: 113,515,749 (GRCm39) I223F probably damaging Het
Stac3 T C 10: 127,339,787 (GRCm39) probably null Het
Tas1r2 A G 4: 139,387,162 (GRCm39) N207S probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Tgm5 T C 2: 120,907,429 (GRCm39) E98G possibly damaging Het
Tktl2 A G 8: 66,965,504 (GRCm39) E354G probably benign Het
Tmem94 G A 11: 115,682,787 (GRCm39) R608H probably damaging Het
Tnrc6a G A 7: 122,770,315 (GRCm39) V702I probably damaging Het
Trappc10 A G 10: 78,047,357 (GRCm39) S380P possibly damaging Het
Trim24 G A 6: 37,880,587 (GRCm39) probably null Het
Ugt1a2 A G 1: 88,128,846 (GRCm39) Y163C probably damaging Het
Vmn1r215 A G 13: 23,260,343 (GRCm39) I128V probably benign Het
Vmn2r50 T A 7: 9,781,640 (GRCm39) E368D possibly damaging Het
Vmn2r59 T C 7: 41,693,190 (GRCm39) N470S probably damaging Het
Vps45 T C 3: 95,948,757 (GRCm39) T333A probably benign Het
Zbtb44 T A 9: 30,965,539 (GRCm39) D316E probably damaging Het
Zdhhc1 C T 8: 106,210,190 (GRCm39) V76M probably benign Het
Zfp235 T C 7: 23,841,549 (GRCm39) F656S probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAAATGAGGAATGTTGCTCTAGC -3'
(R):5'- CCACACCAGTGCATGTGATC -3'

Sequencing Primer
(F):5'- CTCTAGCAAAGTGAGCTAACGAACTG -3'
(R):5'- CCAGTGCATGTGATCAAATCC -3'
Posted On 2014-12-04