Incidental Mutation 'R2863:Wdr35'
ID253045
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission 040453-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2863 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 9028060 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1139 (Y1139*)
Ref Sequence ENSEMBL: ENSMUSP00000106742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085741] [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000219470] [ENSMUST00000219488]
Predicted Effect probably benign
Transcript: ENSMUST00000085741
SMART Domains Protein: ENSMUSP00000082891
Gene: ENSMUSG00000066637

DomainStartEndE-ValueType
Pfam:TPR_9 12 58 1.2e-2 PFAM
Pfam:TPR_12 51 121 1e-9 PFAM
Pfam:TPR_11 53 120 1.2e-14 PFAM
Pfam:TPR_1 55 88 3.5e-6 PFAM
Pfam:TPR_9 70 134 4.9e-7 PFAM
Pfam:TPR_1 90 122 1e-10 PFAM
Pfam:TPR_2 91 122 8.3e-11 PFAM
Pfam:TPR_8 91 122 2.5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085745
AA Change: Y1150*
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: Y1150*

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111113
AA Change: Y1139*
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: Y1139*

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159735
Predicted Effect probably benign
Transcript: ENSMUST00000219470
Predicted Effect probably benign
Transcript: ENSMUST00000219488
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,885,957 N592K probably damaging Het
Bag5 T C 12: 111,710,595 T265A probably benign Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Boc A G 16: 44,492,960 S514P probably benign Het
Ccdc114 T C 7: 45,948,312 S549P probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Epb41l3 C T 17: 69,210,321 P115S probably benign Het
Exoc6 T C 19: 37,653,413 F709S probably benign Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Ldb2 T C 5: 44,480,324 Q214R probably damaging Het
Mus81 T G 19: 5,486,500 Y146S probably damaging Het
Myh11 T C 16: 14,239,426 I335V probably benign Het
Nid2 G A 14: 19,768,403 E322K possibly damaging Het
Ofcc1 A T 13: 40,072,760 S765R probably damaging Het
Ofcc1 T A 13: 40,087,938 H698L possibly damaging Het
Olfr923 T A 9: 38,828,539 F283I possibly damaging Het
Otog T G 7: 46,269,306 C935W probably damaging Het
Pcdhga3 T C 18: 37,674,590 V32A probably damaging Het
Phc3 C T 3: 30,914,128 D920N probably damaging Het
Pou6f1 A G 15: 100,580,808 probably null Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Prkag2 T A 5: 25,021,792 T156S probably benign Het
Psd T C 19: 46,314,762 D95G probably damaging Het
Riox2 A G 16: 59,489,393 D370G probably damaging Het
Spink14 T A 18: 44,030,881 C39S probably damaging Het
Tdrd9 T C 12: 112,031,261 V728A probably benign Het
Tgm2 T C 2: 158,143,099 E29G probably benign Het
Wdr95 T A 5: 149,581,856 C367* probably null Het
Zfp35 T A 18: 24,004,295 D565E probably damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCATTCACCTGAAGCTTGGCTAG -3'
(R):5'- TCAAGCTCTACGACACAGTC -3'

Sequencing Primer
(F):5'- CCTGAAGCTTGGCTAGTATAAAGCAC -3'
(R):5'- GACACAGTCGGGTGCAG -3'
Posted On2014-12-04