Incidental Mutation 'R2471:F3'
ID253073
Institutional Source Beutler Lab
Gene Symbol F3
Ensembl Gene ENSMUSG00000028128
Gene Namecoagulation factor III
SynonymsTF, Cf3, tissue factor, Cf-3, CD142
MMRRC Submission 040403-MU
Accession Numbers

Genbank: NM_010171

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121723537-121735048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121725040 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 51 (W51L)
Ref Sequence ENSEMBL: ENSMUSP00000029771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029771]
Predicted Effect probably damaging
Transcript: ENSMUST00000029771
AA Change: W51L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029771
Gene: ENSMUSG00000028128
AA Change: W51L

DomainStartEndE-ValueType
Pfam:Tissue_fac 12 110 1.1e-26 PFAM
Pfam:Interfer-bind 138 245 5.1e-26 PFAM
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197731
Predicted Effect probably benign
Transcript: ENSMUST00000199997
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired blood vessel development, retarded growth, and, in most cases, midgestational lethality. On a mixed background, some mutants survive to birth and appear to be normal. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Targeted, other(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in F3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:F3 APN 3 121731674 missense possibly damaging 0.83
G5030:F3 UTSW 3 121724999 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0622:F3 UTSW 3 121725019 missense probably damaging 1.00
R1367:F3 UTSW 3 121729374 missense probably damaging 0.98
R1371:F3 UTSW 3 121732510 missense probably damaging 1.00
R1925:F3 UTSW 3 121729383 missense probably damaging 1.00
R2100:F3 UTSW 3 121732433 missense possibly damaging 0.61
R2366:F3 UTSW 3 121732545 splice site probably null
R4577:F3 UTSW 3 121734114 missense probably benign 0.02
R5752:F3 UTSW 3 121732404 missense probably damaging 1.00
R6440:F3 UTSW 3 121725037 missense probably damaging 1.00
R6713:F3 UTSW 3 121731674 missense possibly damaging 0.83
R6845:F3 UTSW 3 121732475 missense probably benign 0.02
R6867:F3 UTSW 3 121729371 missense possibly damaging 0.93
R7145:F3 UTSW 3 121731586 missense probably damaging 1.00
R7511:F3 UTSW 3 121731557 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCCTCTGCTCTTGACAAG -3'
(R):5'- TAGCCAGCAGATTACCATGAC -3'

Sequencing Primer
(F):5'- CTGCTCTTGACAAGTTAGCAACG -3'
(R):5'- TACCATGACAACTCTACCATTTGG -3'
Posted On2014-12-04