Incidental Mutation 'R2471:Emcn'
ID253075
Institutional Source Beutler Lab
Gene Symbol Emcn
Ensembl Gene ENSMUSG00000054690
Gene Nameendomucin
Synonyms0610012K22Rik
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location137341067-137432185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137404011 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 138 (T138M)
Ref Sequence ENSEMBL: ENSMUSP00000112603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119475] [ENSMUST00000122064] [ENSMUST00000197511]
Predicted Effect probably benign
Transcript: ENSMUST00000119475
SMART Domains Protein: ENSMUSP00000114102
Gene: ENSMUSG00000054690

DomainStartEndE-ValueType
Pfam:Endomucin 1 248 5.2e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122064
AA Change: T138M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112603
Gene: ENSMUSG00000054690
AA Change: T138M

DomainStartEndE-ValueType
Pfam:Endomucin 1 261 4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128985
Predicted Effect possibly damaging
Transcript: ENSMUST00000197511
AA Change: T100M

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142467
Gene: ENSMUSG00000054690
AA Change: T100M

DomainStartEndE-ValueType
Pfam:Endomucin 1 92 1.3e-38 PFAM
Pfam:Endomucin 89 219 4.8e-80 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EMCN is a mucin-like sialoglycoprotein that interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix (Kinoshita et al., 2001 [PubMed 11418125]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Emcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Emcn APN 3 137379877 missense probably benign 0.11
IGL02250:Emcn APN 3 137418986 splice site probably benign
IGL03035:Emcn APN 3 137372851 critical splice donor site probably null
R0101:Emcn UTSW 3 137341240 start codon destroyed possibly damaging 0.51
R0180:Emcn UTSW 3 137418994 critical splice acceptor site probably null
R0329:Emcn UTSW 3 137416814 splice site probably benign
R0348:Emcn UTSW 3 137372847 nonsense probably null
R1475:Emcn UTSW 3 137379907 missense possibly damaging 0.92
R2224:Emcn UTSW 3 137404017 missense possibly damaging 0.93
R2226:Emcn UTSW 3 137404017 missense possibly damaging 0.93
R2227:Emcn UTSW 3 137404017 missense possibly damaging 0.93
R4057:Emcn UTSW 3 137379899 missense probably damaging 0.98
R4456:Emcn UTSW 3 137379847 nonsense probably null
R4823:Emcn UTSW 3 137423426 missense probably damaging 1.00
R5043:Emcn UTSW 3 137391601 missense possibly damaging 0.95
R5326:Emcn UTSW 3 137379877 missense probably benign 0.11
R5542:Emcn UTSW 3 137379877 missense probably benign 0.11
R6925:Emcn UTSW 3 137419002 missense probably damaging 0.99
R7137:Emcn UTSW 3 137403991 missense probably damaging 0.98
R7148:Emcn UTSW 3 137417094 missense possibly damaging 0.95
R7265:Emcn UTSW 3 137417078 missense probably damaging 0.97
R7265:Emcn UTSW 3 137419076 missense probably damaging 0.99
R8243:Emcn UTSW 3 137391650 missense possibly damaging 0.92
R8436:Emcn UTSW 3 137423467 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGCTCTGAGGTTTCCTACAATCAC -3'
(R):5'- TAGCTCCTCACGTATATCCTGG -3'

Sequencing Primer
(F):5'- CAAAGACCCATGAGTCTATTATCTGG -3'
(R):5'- ATCCTGGATATTTCTAGTTTCAGCC -3'
Posted On2014-12-04