Incidental Mutation 'R2471:Slc31a2'
ID253076
Institutional Source Beutler Lab
Gene Symbol Slc31a2
Ensembl Gene ENSMUSG00000066152
Gene Namesolute carrier family 31, member 2
Synonyms
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location62262562-62298411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62296075 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 86 (R86W)
Ref Sequence ENSEMBL: ENSMUSP00000103092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084530] [ENSMUST00000107467] [ENSMUST00000107468]
Predicted Effect probably benign
Transcript: ENSMUST00000084527
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084530
AA Change: R88W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081578
Gene: ENSMUSG00000066152
AA Change: R88W

DomainStartEndE-ValueType
Pfam:Ctr 1 136 1.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107467
AA Change: R86W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103091
Gene: ENSMUSG00000066152
AA Change: R86W

DomainStartEndE-ValueType
Pfam:Ctr 1 134 3.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107468
AA Change: R86W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103092
Gene: ENSMUSG00000066152
AA Change: R86W

DomainStartEndE-ValueType
Pfam:Ctr 1 134 3.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139308
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Slc31a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Slc31a2 APN 4 62292696 missense probably damaging 0.97
IGL01977:Slc31a2 APN 4 62295960 missense probably damaging 1.00
IGL01990:Slc31a2 APN 4 62295970 missense probably benign 0.20
IGL02396:Slc31a2 APN 4 62297073 missense probably damaging 1.00
R0410:Slc31a2 UTSW 4 62292653 missense probably benign
R4801:Slc31a2 UTSW 4 62292632 missense probably damaging 1.00
R4802:Slc31a2 UTSW 4 62292632 missense probably damaging 1.00
R4916:Slc31a2 UTSW 4 62297088 missense probably damaging 0.97
R5467:Slc31a2 UTSW 4 62292687 missense probably damaging 1.00
R5795:Slc31a2 UTSW 4 62297052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTGGTAGTCTTGCTCC -3'
(R):5'- CAGTACAGGTGTGAAGTTCCCTG -3'

Sequencing Primer
(F):5'- CTCCTGGCAGTACTGTATGAG -3'
(R):5'- GTGTGAAGTTCCCTGCAGAAATCC -3'
Posted On2014-12-04