Mutagenetix > Incidental Mutations

Incidental Mutation 'R2471:Mad1l1'

253078

Institutional Source

Beutler Lab

Gene Symbol

Mad1l1

Ensembl Gene

ENSMUSG00000029554

Gene Name

MAD1 mitotic arrest deficient 1-like 1

Synonyms

Mad1

MMRRC Submission

040403-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140008689-140321552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140261552 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 340 (E340G)

Ref Sequence

ENSEMBL: ENSMUSP00000106453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031534] [ENSMUST00000110829]

Predicted Effect

probably benign
Transcript: ENSMUST00000031534
AA Change: E340G

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031534
Gene: ENSMUSG00000029554
AA Change: E340G

Domain	Start	End	E-Value	Type
Pfam:MAD	54	715	1.6e-272	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110829
AA Change: E340G

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106453
Gene: ENSMUSG00000029554
AA Change: E340G

Domain	Start	End	E-Value	Type
Pfam:MAD	2	511	2.5e-198	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132832

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele die in utero. Aging heterozygous null mice show increased tumor incidence while heterozygous MEFs are more prone to aneuploidy, induce fibrosarcomas in athymic nude mice, and show a weaker spindle assembly checkpoint-mediated arrest n response to nocodazole. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,980,863	M390K	probably benign	Het
Bicra	A	G	7: 15,972,332	S1395P	probably benign	Het
Cacnb2	G	A	2: 14,984,314	D402N	probably damaging	Het
Csmd1	T	A	8: 16,211,762	D907V	probably damaging	Het
Cstl1	T	A	2: 148,751,121	Y65*	probably null	Het
Dnajc1	T	C	2: 18,219,816	I213V	possibly damaging	Het
Emcn	C	T	3: 137,404,011	T138M	probably damaging	Het
F3	G	T	3: 121,725,040	W51L	probably damaging	Het
Far2	A	G	6: 148,138,694	Y41C	probably damaging	Het
Flrt1	A	T	19: 7,096,491	D230E	probably damaging	Het
Gimap7	G	A	6: 48,724,052	V191M	probably damaging	Het
Gm19402	A	T	10: 77,690,520		probably benign	Het
Ipo5	A	C	14: 120,922,162	K134T	probably benign	Het
Kcnf1	T	C	12: 17,175,530	E230G	probably damaging	Het
Map4k5	T	C	12: 69,856,846	I62V	probably benign	Het
March7	A	G	2: 60,236,900	K588R	possibly damaging	Het
Mctp2	T	A	7: 72,161,161	K52*	probably null	Het
Nr1h4	A	T	10: 89,473,894	F310L	probably damaging	Het
Ofcc1	G	A	13: 40,097,025	S605F	probably damaging	Het
Olfr1369-ps1	A	T	13: 21,116,429	T246S	probably damaging	Het
Olfr1447	G	A	19: 12,901,315	T155I	probably benign	Het
Olfr209	A	T	16: 59,361,581	S212R	possibly damaging	Het
Pcdh20	T	G	14: 88,467,236	E876A	probably benign	Het
Plce1	C	T	19: 38,779,926	A2215V	probably damaging	Het
Ptprg	T	C	14: 12,210,327	Y128H	probably damaging	Het
Sigirr	A	G	7: 141,092,597	L204S	probably damaging	Het
Slc2a12	A	T	10: 22,664,807	Y187F	probably damaging	Het
Slc31a2	A	T	4: 62,296,075	R86W	probably null	Het
Smc1b	T	C	15: 85,092,017	K830E	probably damaging	Het
Ssrp1	A	G	2: 85,042,298	N427D	possibly damaging	Het
Taar9	A	T	10: 24,109,391	F48L	probably benign	Het
Taok2	T	C	7: 126,875,100	E319G	probably damaging	Het
Try10	T	C	6: 41,356,746	S142P	probably damaging	Het
Tsc22d1	A	G	14: 76,418,204	T626A	probably benign	Het
Zfp101	T	C	17: 33,380,976	E602G	possibly damaging	Het

Other mutations in Mad1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01570:Mad1l1	APN	5	140117277	missense	probably benign	0.00
IGL02098:Mad1l1	APN	5	140310589	splice site	probably benign
IGL02100:Mad1l1	APN	5	140143934	missense	probably damaging	1.00
IGL03131:Mad1l1	APN	5	140307703	missense	probably benign	0.18
R0738:Mad1l1	UTSW	5	140300560	missense	probably damaging	1.00
R1902:Mad1l1	UTSW	5	140303688	missense	possibly damaging	0.57
R1989:Mad1l1	UTSW	5	140303670	missense	probably benign	0.27
R2090:Mad1l1	UTSW	5	140009256	missense	probably benign	0.01
R4049:Mad1l1	UTSW	5	140132816	missense	probably damaging	1.00
R4050:Mad1l1	UTSW	5	140132816	missense	probably damaging	1.00
R4096:Mad1l1	UTSW	5	140307673	missense	probably benign	0.01
R4682:Mad1l1	UTSW	5	140300252	missense	possibly damaging	0.47
R4729:Mad1l1	UTSW	5	140261511	missense	possibly damaging	0.76
R4838:Mad1l1	UTSW	5	140300262	nonsense	probably null
R5946:Mad1l1	UTSW	5	140261579	missense	probably damaging	1.00
R6088:Mad1l1	UTSW	5	140193963	missense	probably benign	0.13
R6362:Mad1l1	UTSW	5	140315055	missense	possibly damaging	0.71
R6845:Mad1l1	UTSW	5	140009169	missense	probably damaging	1.00
R6957:Mad1l1	UTSW	5	140065817	missense	probably damaging	0.99
R6983:Mad1l1	UTSW	5	140193984	missense	probably damaging	0.99
R7347:Mad1l1	UTSW	5	140144044	missense	probably damaging	1.00
R7807:Mad1l1	UTSW	5	140088786	missense	probably benign	0.01
R8147:Mad1l1	UTSW	5	140143979	missense	probably damaging	1.00
R8165:Mad1l1	UTSW	5	140315058	missense	probably benign
U24488:Mad1l1	UTSW	5	140315085	missense	probably damaging	1.00
X0026:Mad1l1	UTSW	5	140009205	missense	probably damaging	1.00
Z1177:Mad1l1	UTSW	5	140105582	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TAGCAGAGCTACACCCGAATAATG -3'
(R):5'- TGGGCTGCAGAGTGAACTTC -3'

Sequencing Primer
(F):5'- GTTCTTGAAAAGTATCCAGCCC -3'
(R):5'- GTGAACTTCCACAGACCTCTGAATTG -3'

Posted On

2014-12-04