Mutagenetix > Incidental Mutations

Incidental Mutation 'R2471:Try10'

253080

Institutional Source

Beutler Lab

Gene Symbol

Try10

Ensembl Gene

ENSMUSG00000071521

Gene Name

trypsin 10

Synonyms

trypsinogen 10

MMRRC Submission

040403-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R2471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41354105-41357914 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41356746 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 142 (S142P)

Ref Sequence

ENSEMBL: ENSMUSP00000071976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072103]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072103
AA Change: S142P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071976
Gene: ENSMUSG00000071521
AA Change: S142P

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
Tryp_SPc	23	239	3.38e-104	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,980,863	M390K	probably benign	Het
Bicra	A	G	7: 15,972,332	S1395P	probably benign	Het
Cacnb2	G	A	2: 14,984,314	D402N	probably damaging	Het
Csmd1	T	A	8: 16,211,762	D907V	probably damaging	Het
Cstl1	T	A	2: 148,751,121	Y65*	probably null	Het
Dnajc1	T	C	2: 18,219,816	I213V	possibly damaging	Het
Emcn	C	T	3: 137,404,011	T138M	probably damaging	Het
F3	G	T	3: 121,725,040	W51L	probably damaging	Het
Far2	A	G	6: 148,138,694	Y41C	probably damaging	Het
Flrt1	A	T	19: 7,096,491	D230E	probably damaging	Het
Gimap7	G	A	6: 48,724,052	V191M	probably damaging	Het
Gm19402	A	T	10: 77,690,520		probably benign	Het
Ipo5	A	C	14: 120,922,162	K134T	probably benign	Het
Kcnf1	T	C	12: 17,175,530	E230G	probably damaging	Het
Mad1l1	T	C	5: 140,261,552	E340G	probably benign	Het
Map4k5	T	C	12: 69,856,846	I62V	probably benign	Het
March7	A	G	2: 60,236,900	K588R	possibly damaging	Het
Mctp2	T	A	7: 72,161,161	K52*	probably null	Het
Nr1h4	A	T	10: 89,473,894	F310L	probably damaging	Het
Ofcc1	G	A	13: 40,097,025	S605F	probably damaging	Het
Olfr1369-ps1	A	T	13: 21,116,429	T246S	probably damaging	Het
Olfr1447	G	A	19: 12,901,315	T155I	probably benign	Het
Olfr209	A	T	16: 59,361,581	S212R	possibly damaging	Het
Pcdh20	T	G	14: 88,467,236	E876A	probably benign	Het
Plce1	C	T	19: 38,779,926	A2215V	probably damaging	Het
Ptprg	T	C	14: 12,210,327	Y128H	probably damaging	Het
Sigirr	A	G	7: 141,092,597	L204S	probably damaging	Het
Slc2a12	A	T	10: 22,664,807	Y187F	probably damaging	Het
Slc31a2	A	T	4: 62,296,075	R86W	probably null	Het
Smc1b	T	C	15: 85,092,017	K830E	probably damaging	Het
Ssrp1	A	G	2: 85,042,298	N427D	possibly damaging	Het
Taar9	A	T	10: 24,109,391	F48L	probably benign	Het
Taok2	T	C	7: 126,875,100	E319G	probably damaging	Het
Tsc22d1	A	G	14: 76,418,204	T626A	probably benign	Het
Zfp101	T	C	17: 33,380,976	E602G	possibly damaging	Het

Other mutations in Try10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02001:Try10	APN	6	41356589	missense	probably benign	0.00
IGL02608:Try10	APN	6	41355487	missense	probably damaging	1.00
IGL03280:Try10	APN	6	41354220	missense	probably benign	0.18
R0332:Try10	UTSW	6	41354220	missense	probably benign	0.18
R1628:Try10	UTSW	6	41357456	missense	probably damaging	1.00
R2149:Try10	UTSW	6	41356561	missense	probably benign	0.02
R3764:Try10	UTSW	6	41356524	missense	probably benign	0.07
R4008:Try10	UTSW	6	41356674	missense	probably benign	0.00
R4660:Try10	UTSW	6	41357827	missense	probably damaging	1.00
R4792:Try10	UTSW	6	41355452	missense	probably benign	0.33
R5185:Try10	UTSW	6	41356549	missense	probably damaging	0.96
R6103:Try10	UTSW	6	41356550	missense	probably damaging	0.98
R6301:Try10	UTSW	6	41355589	missense	probably benign	0.30
R6692:Try10	UTSW	6	41357821	missense	probably damaging	1.00
R7786:Try10	UTSW	6	41355529	missense	possibly damaging	0.86
R8391:Try10	UTSW	6	41357372	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGCCGCATCCAAGTGAG -3'
(R):5'- AAGGTCATTTTGTGTGCAACTC -3'

Sequencing Primer
(F):5'- CAACATCAACGTCCTGGAGGG -3'
(R):5'- GTGCAACTCTCTCTAATACCCACTG -3'

Posted On

2014-12-04