Incidental Mutation 'R2471:Bicra'
ID253086
Institutional Source Beutler Lab
Gene Symbol Bicra
Ensembl Gene ENSMUSG00000070808
Gene NameBRD4 interacting chromatin remodeling complex associated protein
SynonymsGltscr1
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location15970672-16047921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15972332 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1395 (S1395P)
Ref Sequence ENSEMBL: ENSMUSP00000148012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000098799] [ENSMUST00000144956] [ENSMUST00000210781]
Predicted Effect probably benign
Transcript: ENSMUST00000094821
AA Change: S1395P

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: S1395P

DomainStartEndE-ValueType
low complexity region 86 96 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
internal_repeat_1 156 298 1.03e-6 PROSPERO
low complexity region 308 323 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
internal_repeat_1 479 614 1.03e-6 PROSPERO
low complexity region 619 638 N/A INTRINSIC
low complexity region 642 676 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 756 782 N/A INTRINSIC
low complexity region 790 819 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 852 906 N/A INTRINSIC
low complexity region 940 950 N/A INTRINSIC
low complexity region 987 1006 N/A INTRINSIC
Pfam:GLTSCR1 1094 1202 4.6e-43 PFAM
low complexity region 1232 1251 N/A INTRINSIC
low complexity region 1275 1294 N/A INTRINSIC
low complexity region 1349 1371 N/A INTRINSIC
low complexity region 1460 1473 N/A INTRINSIC
low complexity region 1535 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098799
SMART Domains Protein: ENSMUSP00000096397
Gene: ENSMUSG00000074364

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 4.1e-19 PFAM
Pfam:MMR_HSR1 60 220 2.2e-7 PFAM
Pfam:Dynamin_N 61 221 2.4e-14 PFAM
EH 443 536 2.96e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144956
SMART Domains Protein: ENSMUSP00000119933
Gene: ENSMUSG00000074364

DomainStartEndE-ValueType
Pfam:MMR_HSR1 4 84 2.4e-7 PFAM
Pfam:Dynamin_N 4 85 1.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210713
Predicted Effect probably benign
Transcript: ENSMUST00000210781
AA Change: S1395P

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Bicra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Bicra APN 7 15996577 missense possibly damaging 0.70
IGL01521:Bicra APN 7 15989188 missense probably benign 0.18
IGL01690:Bicra APN 7 15987753 missense probably benign 0.09
IGL01721:Bicra APN 7 15988699 missense probably benign
IGL01994:Bicra APN 7 15972816 missense possibly damaging 0.46
IGL02084:Bicra APN 7 15987738 missense probably benign 0.09
IGL02312:Bicra APN 7 15993141 missense possibly damaging 0.85
IGL02686:Bicra APN 7 15987915 missense probably benign 0.02
IGL02727:Bicra APN 7 15979465 missense possibly damaging 0.95
IGL03031:Bicra APN 7 15975801 missense probably benign 0.16
R0003:Bicra UTSW 7 15971887 missense probably benign
R0025:Bicra UTSW 7 15987511 missense possibly damaging 0.53
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0241:Bicra UTSW 7 15975145 missense probably damaging 1.00
R0417:Bicra UTSW 7 15972322 missense probably damaging 1.00
R0437:Bicra UTSW 7 15988762 missense possibly damaging 0.73
R0547:Bicra UTSW 7 15972248 missense probably damaging 1.00
R0688:Bicra UTSW 7 15989322 missense probably damaging 1.00
R0855:Bicra UTSW 7 15972004 missense probably damaging 1.00
R1448:Bicra UTSW 7 15988359 missense possibly damaging 0.86
R1637:Bicra UTSW 7 15972689 missense probably benign 0.19
R1899:Bicra UTSW 7 15987751 missense possibly damaging 0.53
R2035:Bicra UTSW 7 15996413 missense possibly damaging 0.53
R2247:Bicra UTSW 7 15989234 missense probably benign 0.33
R2484:Bicra UTSW 7 15988680 missense possibly damaging 0.96
R3437:Bicra UTSW 7 15989298 missense possibly damaging 0.85
R3551:Bicra UTSW 7 15979733 missense probably benign 0.33
R4816:Bicra UTSW 7 15988906 missense possibly damaging 0.53
R4901:Bicra UTSW 7 15987601 missense possibly damaging 0.53
R5035:Bicra UTSW 7 15979424 missense possibly damaging 0.90
R5078:Bicra UTSW 7 15975457 missense probably damaging 1.00
R5094:Bicra UTSW 7 15975371 missense probably damaging 1.00
R5195:Bicra UTSW 7 15979953 missense possibly damaging 0.93
R5496:Bicra UTSW 7 15987841 missense probably benign 0.33
R5780:Bicra UTSW 7 15979754 missense possibly damaging 0.96
R6541:Bicra UTSW 7 15979129 missense probably benign 0.00
R6560:Bicra UTSW 7 15989194 missense possibly damaging 0.53
R6575:Bicra UTSW 7 15979131 missense probably benign 0.25
R6854:Bicra UTSW 7 15988762 missense probably benign 0.18
R6967:Bicra UTSW 7 15972205 missense probably damaging 0.97
R7283:Bicra UTSW 7 15972500 missense probably damaging 1.00
R7454:Bicra UTSW 7 15972134 missense probably benign 0.30
R7462:Bicra UTSW 7 15979135 missense possibly damaging 0.84
R7488:Bicra UTSW 7 15989442 critical splice acceptor site probably null
R7506:Bicra UTSW 7 15988213 missense possibly damaging 0.96
R7534:Bicra UTSW 7 15971935 missense probably damaging 0.98
R7915:Bicra UTSW 7 15988522 missense probably benign
R8063:Bicra UTSW 7 15979044 missense probably benign
R8147:Bicra UTSW 7 15988470 missense possibly damaging 0.93
X0064:Bicra UTSW 7 15975775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATAGTTCATCCTCCACCGCTG -3'
(R):5'- GAGCCGCATTGGTCTCAAAC -3'

Sequencing Primer
(F):5'- TGCCAGCTCCCGGATCAG -3'
(R):5'- GCATTGGTCTCAAACTCAAGATC -3'
Posted On2014-12-04