Incidental Mutation 'R2471:Mctp2'
ID253088
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Namemultiple C2 domains, transmembrane 2
SynonymsLOC244049
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location72077830-72306608 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 72161161 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 52 (K52*)
Ref Sequence ENSEMBL: ENSMUSP00000145571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323] [ENSMUST00000205410]
Predicted Effect probably benign
Transcript: ENSMUST00000079323
AA Change: L688F

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776
AA Change: L688F

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205410
AA Change: K52*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206991
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 72185815 missense probably damaging 0.96
IGL01296:Mctp2 APN 7 72228526 missense probably benign 0.03
IGL01509:Mctp2 APN 7 72259269 missense probably benign 0.01
IGL02074:Mctp2 APN 7 72161258 missense probably damaging 0.99
IGL02185:Mctp2 APN 7 72080823 missense probably benign 0.13
IGL02238:Mctp2 APN 7 72090205 nonsense probably null
IGL02707:Mctp2 APN 7 72259341 missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 72245542 missense probably damaging 0.99
IGL02869:Mctp2 APN 7 72228471 critical splice donor site probably null
IGL03354:Mctp2 APN 7 72161244 missense probably benign 0.00
IGL03397:Mctp2 APN 7 72259277 missense probably damaging 0.98
IGL03407:Mctp2 APN 7 72211652 missense probably benign 0.05
trifecta UTSW 7 72259331 missense possibly damaging 0.63
triumvirate UTSW 7 72211690 missense probably damaging 1.00
troika UTSW 7 72185820 missense probably damaging 1.00
F5770:Mctp2 UTSW 7 72121751 splice site probably benign
PIT4131001:Mctp2 UTSW 7 72090257 missense probably damaging 1.00
R0013:Mctp2 UTSW 7 72229408 missense probably benign 0.00
R0079:Mctp2 UTSW 7 72214116 splice site probably benign
R0083:Mctp2 UTSW 7 72228516 missense possibly damaging 0.94
R0173:Mctp2 UTSW 7 72247107 critical splice donor site probably null
R0302:Mctp2 UTSW 7 72090264 missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 72080822 missense probably benign 0.00
R0675:Mctp2 UTSW 7 72083170 missense probably damaging 1.00
R1076:Mctp2 UTSW 7 72185867 critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 72259139 missense probably benign
R1356:Mctp2 UTSW 7 72164723 unclassified probably benign
R1628:Mctp2 UTSW 7 72211589 splice site probably null
R1649:Mctp2 UTSW 7 72161258 missense probably damaging 0.99
R1981:Mctp2 UTSW 7 72164698 missense probably benign 0.01
R2256:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2257:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2327:Mctp2 UTSW 7 72211610 missense probably damaging 0.99
R2407:Mctp2 UTSW 7 72200407 missense probably benign 0.40
R3706:Mctp2 UTSW 7 72214111 splice site probably benign
R4023:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4025:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 72259337 missense probably benign
R4272:Mctp2 UTSW 7 72259331 missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 72183851 missense probably damaging 1.00
R4654:Mctp2 UTSW 7 72090194 missense probably damaging 1.00
R4815:Mctp2 UTSW 7 72259349 missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 72259269 missense probably benign 0.00
R5389:Mctp2 UTSW 7 72214087 missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 72245459 critical splice donor site probably null
R5878:Mctp2 UTSW 7 72214108 missense probably benign 0.01
R5918:Mctp2 UTSW 7 72228540 missense probably damaging 1.00
R5956:Mctp2 UTSW 7 72259175 missense probably benign
R5964:Mctp2 UTSW 7 72103177 missense probably damaging 0.97
R5978:Mctp2 UTSW 7 72090188 missense probably damaging 1.00
R6054:Mctp2 UTSW 7 72259103 missense probably benign
R6475:Mctp2 UTSW 7 72200344 critical splice donor site probably null
R6849:Mctp2 UTSW 7 72211718 missense probably damaging 1.00
R6963:Mctp2 UTSW 7 72228056 missense probably damaging 1.00
R7366:Mctp2 UTSW 7 72259214 missense probably benign 0.00
R7468:Mctp2 UTSW 7 72211690 missense probably damaging 1.00
R7746:Mctp2 UTSW 7 72185796 missense probably benign
R7765:Mctp2 UTSW 7 72090331 splice site probably null
R7822:Mctp2 UTSW 7 72127187 missense possibly damaging 0.90
R7984:Mctp2 UTSW 7 72103189 missense possibly damaging 0.94
R8416:Mctp2 UTSW 7 72202462 missense probably benign 0.12
X0066:Mctp2 UTSW 7 72259280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGAAACATATAGAGACTGGCTC -3'
(R):5'- CTACAGCAGCTGATCTTAGGG -3'

Sequencing Primer
(F):5'- GAGACTGGCTCTTTTAAGCTCAGC -3'
(R):5'- CAGCAGCTGATCTTAGGGAATATCC -3'
Posted On2014-12-04