Incidental Mutation 'R2471:Sigirr'
ID253092
Institutional Source Beutler Lab
Gene Symbol Sigirr
Ensembl Gene ENSMUSG00000025494
Gene Namesingle immunoglobulin and toll-interleukin 1 receptor (TIR) domain
SynonymsTir8, Sigirr
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141091175-141100572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141092597 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 204 (L204S)
Ref Sequence ENSEMBL: ENSMUSP00000147280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066873] [ENSMUST00000097958] [ENSMUST00000106039] [ENSMUST00000209199] [ENSMUST00000209294] [ENSMUST00000209352] [ENSMUST00000210167]
Predicted Effect probably benign
Transcript: ENSMUST00000066873
SMART Domains Protein: ENSMUSP00000069961
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
ARM 350 390 8.11e-5 SMART
ARM 392 432 3.24e-4 SMART
ARM 489 536 3.85e0 SMART
internal_repeat_1 605 702 2.91e-9 PROSPERO
low complexity region 717 731 N/A INTRINSIC
low complexity region 757 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097958
AA Change: L204S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494
AA Change: L204S

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106039
SMART Domains Protein: ENSMUSP00000101654
Gene: ENSMUSG00000054065

DomainStartEndE-ValueType
low complexity region 65 79 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 204 219 N/A INTRINSIC
low complexity region 244 253 N/A INTRINSIC
ARM 375 415 8.11e-5 SMART
ARM 417 457 3.24e-4 SMART
ARM 514 561 3.85e0 SMART
internal_repeat_1 630 727 4.99e-9 PROSPERO
low complexity region 742 756 N/A INTRINSIC
low complexity region 782 799 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161142
Predicted Effect probably benign
Transcript: ENSMUST00000209199
Predicted Effect probably damaging
Transcript: ENSMUST00000209294
AA Change: L204S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000209352
Predicted Effect probably benign
Transcript: ENSMUST00000209887
Predicted Effect probably damaging
Transcript: ENSMUST00000210167
AA Change: L204S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210978
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: When challenged, homozygous mutant mice show an increased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Sigirr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Sigirr APN 7 141092234 missense probably benign 0.29
IGL02166:Sigirr APN 7 141092227 missense probably benign 0.02
IGL02662:Sigirr APN 7 141094794 start gained probably benign
R0044:Sigirr UTSW 7 141092313 splice site probably null
R0081:Sigirr UTSW 7 141091372 missense probably damaging 1.00
R0512:Sigirr UTSW 7 141092420 missense probably benign 0.01
R0651:Sigirr UTSW 7 141093067 missense possibly damaging 0.94
R0652:Sigirr UTSW 7 141093067 missense possibly damaging 0.94
R3028:Sigirr UTSW 7 141092279 missense probably damaging 0.99
R4786:Sigirr UTSW 7 141091433 missense probably benign 0.17
R4910:Sigirr UTSW 7 141093788 missense probably damaging 1.00
R5615:Sigirr UTSW 7 141092719 missense probably damaging 0.99
R5861:Sigirr UTSW 7 141091379 missense probably damaging 1.00
R5944:Sigirr UTSW 7 141091387 missense probably damaging 1.00
R6764:Sigirr UTSW 7 141093242 missense probably benign 0.01
R8076:Sigirr UTSW 7 141091872 missense probably benign 0.08
R8266:Sigirr UTSW 7 141091749 missense unknown
X0010:Sigirr UTSW 7 141093274 missense probably benign 0.00
X0058:Sigirr UTSW 7 141093912 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGAAAGAACCACGATGAGAC -3'
(R):5'- AGTGTCTCAGAAGGGCACAG -3'

Sequencing Primer
(F):5'- CACGATGAGACGCCGACAG -3'
(R):5'- CTGAACATGGACTAGAGGTGCCTC -3'
Posted On2014-12-04