Incidental Mutation 'R2471:Taar9'
ID253099
Institutional Source Beutler Lab
Gene Symbol Taar9
Ensembl Gene ENSMUSG00000037424
Gene Nametrace amine-associated receptor 9
SynonymsTar3, Ta3, Trar3
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24108488-24109534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24109391 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 48 (F48L)
Ref Sequence ENSEMBL: ENSMUSP00000043552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041180]
Predicted Effect probably benign
Transcript: ENSMUST00000041180
AA Change: F48L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043552
Gene: ENSMUSG00000037424
AA Change: F48L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 7.3e-13 PFAM
Pfam:7tm_1 49 311 8.4e-61 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAAR9 is a member of a large family of rhodopsin G protein-coupled receptors (GPCRs, or GPRs). GPCRs contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Jul 2005]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Taar9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Taar9 APN 10 24109531 missense probably benign
IGL02011:Taar9 APN 10 24108579 missense possibly damaging 0.93
IGL02883:Taar9 APN 10 24109480 missense probably benign 0.08
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1598:Taar9 UTSW 10 24109407 missense possibly damaging 0.90
R2072:Taar9 UTSW 10 24108979 missense probably damaging 1.00
R2519:Taar9 UTSW 10 24109254 missense probably damaging 1.00
R4205:Taar9 UTSW 10 24108579 missense possibly damaging 0.93
R4793:Taar9 UTSW 10 24109510 missense probably benign
R4801:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R4802:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R5457:Taar9 UTSW 10 24109105 missense probably damaging 0.98
R6450:Taar9 UTSW 10 24109240 missense probably damaging 1.00
R6601:Taar9 UTSW 10 24109047 missense probably damaging 1.00
R6915:Taar9 UTSW 10 24109012 missense possibly damaging 0.53
R7179:Taar9 UTSW 10 24108984 missense probably damaging 1.00
R7480:Taar9 UTSW 10 24108945 missense possibly damaging 0.61
R8200:Taar9 UTSW 10 24109419 missense probably damaging 0.99
Z1088:Taar9 UTSW 10 24108965 missense probably damaging 1.00
Z1177:Taar9 UTSW 10 24109141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCGGTCAATGGAGATGCAG -3'
(R):5'- CTGGGAAGTTTACAATTACCAAGAC -3'

Sequencing Primer
(F):5'- CACGTGTGGAACTTACAGTAACTCTC -3'
(R):5'- GTTTACAATTACCAAGACTGGAGGC -3'
Posted On2014-12-04