Incidental Mutation 'R2471:Kcnf1'
ID253106
Institutional Source Beutler Lab
Gene Symbol Kcnf1
Ensembl Gene ENSMUSG00000051726
Gene Namepotassium voltage-gated channel, subfamily F, member 1
SynonymsLOC382571
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location17172100-17176888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17175530 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 230 (E230G)
Ref Sequence ENSEMBL: ENSMUSP00000131480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170580]
Predicted Effect probably damaging
Transcript: ENSMUST00000170580
AA Change: E230G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131480
Gene: ENSMUSG00000051726
AA Change: E230G

DomainStartEndE-ValueType
BTB 33 147 2.32e-2 SMART
Pfam:Ion_trans 193 429 1.3e-49 PFAM
Pfam:Ion_trans_2 337 423 3.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Kcnf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Kcnf1 APN 12 17175348 missense probably benign 0.00
IGL02586:Kcnf1 APN 12 17176143 missense probably benign 0.27
R0931:Kcnf1 UTSW 12 17175141 missense possibly damaging 0.89
R1068:Kcnf1 UTSW 12 17175474 missense probably damaging 1.00
R1558:Kcnf1 UTSW 12 17175473 missense probably damaging 1.00
R1571:Kcnf1 UTSW 12 17175852 missense probably benign 0.00
R1607:Kcnf1 UTSW 12 17175732 missense probably benign 0.26
R4013:Kcnf1 UTSW 12 17175993 missense probably benign 0.01
R4095:Kcnf1 UTSW 12 17175479 missense possibly damaging 0.92
R4980:Kcnf1 UTSW 12 17175011 missense possibly damaging 0.88
R5157:Kcnf1 UTSW 12 17174741 missense probably benign
R6017:Kcnf1 UTSW 12 17175081 missense probably damaging 0.97
R7130:Kcnf1 UTSW 12 17175809 missense probably benign 0.27
R7225:Kcnf1 UTSW 12 17175693 missense possibly damaging 0.47
R7308:Kcnf1 UTSW 12 17174729 missense probably benign 0.13
R7614:Kcnf1 UTSW 12 17174786 missense probably benign 0.03
R7624:Kcnf1 UTSW 12 17176136 missense probably benign
R8510:Kcnf1 UTSW 12 17175938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTGGTCAGCTCCATCATTC -3'
(R):5'- TGCAGCTCATCTTGGACGAC -3'

Sequencing Primer
(F):5'- ATTCTTGCGCCCAGGTG -3'
(R):5'- TCATCTTGGACGACCTGGG -3'
Posted On2014-12-04