Mutagenetix > Incidental Mutations

Incidental Mutation 'R2471:Kcnf1'

253106

Institutional Source

Beutler Lab

Gene Symbol

Kcnf1

Ensembl Gene

ENSMUSG00000051726

Gene Name

potassium voltage-gated channel, subfamily F, member 1

Synonyms

LOC382571

MMRRC Submission

040403-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R2471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17172100-17176888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17175530 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 230 (E230G)

Ref Sequence

ENSEMBL: ENSMUSP00000131480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170580]

Predicted Effect

probably damaging
Transcript: ENSMUST00000170580
AA Change: E230G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131480
Gene: ENSMUSG00000051726
AA Change: E230G

Domain	Start	End	E-Value	Type
BTB	33	147	2.32e-2	SMART
Pfam:Ion_trans	193	429	1.3e-49	PFAM
Pfam:Ion_trans_2	337	423	3.4e-14	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,980,863	M390K	probably benign	Het
Bicra	A	G	7: 15,972,332	S1395P	probably benign	Het
Cacnb2	G	A	2: 14,984,314	D402N	probably damaging	Het
Csmd1	T	A	8: 16,211,762	D907V	probably damaging	Het
Cstl1	T	A	2: 148,751,121	Y65*	probably null	Het
Dnajc1	T	C	2: 18,219,816	I213V	possibly damaging	Het
Emcn	C	T	3: 137,404,011	T138M	probably damaging	Het
F3	G	T	3: 121,725,040	W51L	probably damaging	Het
Far2	A	G	6: 148,138,694	Y41C	probably damaging	Het
Flrt1	A	T	19: 7,096,491	D230E	probably damaging	Het
Gimap7	G	A	6: 48,724,052	V191M	probably damaging	Het
Gm19402	A	T	10: 77,690,520		probably benign	Het
Ipo5	A	C	14: 120,922,162	K134T	probably benign	Het
Mad1l1	T	C	5: 140,261,552	E340G	probably benign	Het
Map4k5	T	C	12: 69,856,846	I62V	probably benign	Het
March7	A	G	2: 60,236,900	K588R	possibly damaging	Het
Mctp2	T	A	7: 72,161,161	K52*	probably null	Het
Nr1h4	A	T	10: 89,473,894	F310L	probably damaging	Het
Ofcc1	G	A	13: 40,097,025	S605F	probably damaging	Het
Olfr1369-ps1	A	T	13: 21,116,429	T246S	probably damaging	Het
Olfr1447	G	A	19: 12,901,315	T155I	probably benign	Het
Olfr209	A	T	16: 59,361,581	S212R	possibly damaging	Het
Pcdh20	T	G	14: 88,467,236	E876A	probably benign	Het
Plce1	C	T	19: 38,779,926	A2215V	probably damaging	Het
Ptprg	T	C	14: 12,210,327	Y128H	probably damaging	Het
Sigirr	A	G	7: 141,092,597	L204S	probably damaging	Het
Slc2a12	A	T	10: 22,664,807	Y187F	probably damaging	Het
Slc31a2	A	T	4: 62,296,075	R86W	probably null	Het
Smc1b	T	C	15: 85,092,017	K830E	probably damaging	Het
Ssrp1	A	G	2: 85,042,298	N427D	possibly damaging	Het
Taar9	A	T	10: 24,109,391	F48L	probably benign	Het
Taok2	T	C	7: 126,875,100	E319G	probably damaging	Het
Try10	T	C	6: 41,356,746	S142P	probably damaging	Het
Tsc22d1	A	G	14: 76,418,204	T626A	probably benign	Het
Zfp101	T	C	17: 33,380,976	E602G	possibly damaging	Het

Other mutations in Kcnf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Kcnf1	APN	12	17175348	missense	probably benign	0.00
IGL02586:Kcnf1	APN	12	17176143	missense	probably benign	0.27
R0931:Kcnf1	UTSW	12	17175141	missense	possibly damaging	0.89
R1068:Kcnf1	UTSW	12	17175474	missense	probably damaging	1.00
R1558:Kcnf1	UTSW	12	17175473	missense	probably damaging	1.00
R1571:Kcnf1	UTSW	12	17175852	missense	probably benign	0.00
R1607:Kcnf1	UTSW	12	17175732	missense	probably benign	0.26
R4013:Kcnf1	UTSW	12	17175993	missense	probably benign	0.01
R4095:Kcnf1	UTSW	12	17175479	missense	possibly damaging	0.92
R4980:Kcnf1	UTSW	12	17175011	missense	possibly damaging	0.88
R5157:Kcnf1	UTSW	12	17174741	missense	probably benign
R6017:Kcnf1	UTSW	12	17175081	missense	probably damaging	0.97
R7130:Kcnf1	UTSW	12	17175809	missense	probably benign	0.27
R7225:Kcnf1	UTSW	12	17175693	missense	possibly damaging	0.47
R7308:Kcnf1	UTSW	12	17174729	missense	probably benign	0.13
R7614:Kcnf1	UTSW	12	17174786	missense	probably benign	0.03
R7624:Kcnf1	UTSW	12	17176136	missense	probably benign
R8510:Kcnf1	UTSW	12	17175938	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTTGGTCAGCTCCATCATTC -3'
(R):5'- TGCAGCTCATCTTGGACGAC -3'

Sequencing Primer
(F):5'- ATTCTTGCGCCCAGGTG -3'
(R):5'- TCATCTTGGACGACCTGGG -3'

Posted On

2014-12-04