Mutagenetix > Incidental Mutations

Incidental Mutation 'R2864:Fnip1'

253109

Institutional Source

Beutler Lab

Gene Symbol

Fnip1

Ensembl Gene

ENSMUSG00000035992

Gene Name

folliculin interacting protein 1

Synonyms

A730024A03Rik

Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene?

Possibly essential (E-score: 0.688) question?

Stock #

R2864 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54438199-54518235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54502424 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 562 (I562T)

Ref Sequence

ENSEMBL: ENSMUSP00000049026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046835
AA Change: I562T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: I562T

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000143650
AA Change: I538T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992
AA Change: I538T

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

Meta Mutation Damage Score

0.1675

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap30	G	T	1: 171,408,206	G716V	probably damaging	Het
Crk	T	C	11: 75,703,385	V266A	probably damaging	Het
Dock4	T	A	12: 40,730,073	F624L	probably damaging	Het
Fhod1	T	C	8: 105,332,911	K714R	probably null	Het
Flt1	T	C	5: 147,594,621	Q844R	possibly damaging	Het
Fn1	A	G	1: 71,602,419	V1656A	probably damaging	Het
Gm7168	A	G	17: 13,949,855	K495E	probably benign	Het
Gm884	A	G	11: 103,540,918	F1357S	probably benign	Het
Igf2r	T	C	17: 12,686,724	H2240R	probably damaging	Het
Itpr3	T	C	17: 27,091,551	V436A	probably benign	Het
Lrp1b	G	T	2: 40,874,995	Q2826K	possibly damaging	Het
Luc7l	C	A	17: 26,266,361	Q112K	probably damaging	Het
Misp	A	G	10: 79,827,038	K430E	probably benign	Het
Olfr902	A	G	9: 38,449,388	N172S	possibly damaging	Het
Oprm1	T	A	10: 6,794,226		probably null	Het
Paqr3	C	T	5: 97,099,736	R171H	possibly damaging	Het
Phc3	C	T	3: 30,914,128	D920N	probably damaging	Het
Pigk	T	C	3: 152,722,552	V72A	probably damaging	Het
Prickle1	C	T	15: 93,509,278	G112R	probably damaging	Het
Rrbp1	T	C	2: 143,957,637	E1050G	probably damaging	Het
Vmn2r93	A	T	17: 18,326,061	I732F	probably damaging	Het
Xkr6	T	C	14: 63,819,756	L372P	unknown	Het
Zfp523	T	C	17: 28,202,540	V60A	probably benign	Het

Other mutations in Fnip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01449:Fnip1	APN	11	54499508	missense	probably damaging	1.00
IGL01590:Fnip1	APN	11	54493300	missense	probably damaging	1.00
IGL01959:Fnip1	APN	11	54490912	missense	possibly damaging	0.95
IGL02157:Fnip1	APN	11	54487763	missense	probably damaging	1.00
IGL02197:Fnip1	APN	11	54493374	missense	probably damaging	1.00
IGL02476:Fnip1	APN	11	54499567	splice site	probably benign
IGL02639:Fnip1	APN	11	54475640	nonsense	probably null
IGL02742:Fnip1	APN	11	54493351	missense	probably damaging	1.00
hamel	UTSW	11	54480685	critical splice donor site	probably benign
hamel2	UTSW	11	54502271	missense	probably damaging	1.00
Normandy	UTSW	11	54493181	splice site	probably benign
H8562:Fnip1	UTSW	11	54480297	missense	probably damaging	0.98
P0043:Fnip1	UTSW	11	54503225	missense	probably benign	0.00
R0114:Fnip1	UTSW	11	54487801	splice site	probably benign
R0278:Fnip1	UTSW	11	54489343	splice site	probably null
R0409:Fnip1	UTSW	11	54480354	splice site	probably null
R0840:Fnip1	UTSW	11	54493181	splice site	probably benign
R1131:Fnip1	UTSW	11	54493303	missense	possibly damaging	0.82
R1205:Fnip1	UTSW	11	54502306	missense	possibly damaging	0.91
R1271:Fnip1	UTSW	11	54503297	missense	probably benign
R1817:Fnip1	UTSW	11	54502453	missense	probably benign	0.30
R1826:Fnip1	UTSW	11	54466164	missense	probably damaging	1.00
R1872:Fnip1	UTSW	11	54487735	missense	probably damaging	1.00
R1883:Fnip1	UTSW	11	54515547	missense	probably damaging	1.00
R1917:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1918:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1919:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R2010:Fnip1	UTSW	11	54482503	missense	probably damaging	1.00
R2117:Fnip1	UTSW	11	54500624	missense	probably damaging	1.00
R2329:Fnip1	UTSW	11	54466107	missense	probably damaging	0.98
R2337:Fnip1	UTSW	11	54475737	missense	probably damaging	0.98
R2850:Fnip1	UTSW	11	54502677	missense	probably benign	0.32
R2863:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2865:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R3936:Fnip1	UTSW	11	54480239	splice site	probably null
R4017:Fnip1	UTSW	11	54509987	missense	probably benign	0.14
R4033:Fnip1	UTSW	11	54502471	missense	probably benign	0.02
R4668:Fnip1	UTSW	11	54503559	missense	probably damaging	1.00
R4695:Fnip1	UTSW	11	54499419	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54466171	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54499526	missense	probably benign	0.01
R4777:Fnip1	UTSW	11	54500556	missense	probably damaging	1.00
R4863:Fnip1	UTSW	11	54515556	missense	possibly damaging	0.52
R5369:Fnip1	UTSW	11	54502589	missense	probably benign
R5481:Fnip1	UTSW	11	54502644	missense	probably benign	0.01
R5562:Fnip1	UTSW	11	54489342	critical splice donor site	probably null
R5563:Fnip1	UTSW	11	54504862	missense	probably benign	0.05
R5628:Fnip1	UTSW	11	54503633	missense	probably benign	0.08
R5689:Fnip1	UTSW	11	54502289	missense	probably damaging	1.00
R6009:Fnip1	UTSW	11	54502271	missense	probably damaging	1.00
R6120:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R6429:Fnip1	UTSW	11	54515567	missense	probably damaging	1.00
R6546:Fnip1	UTSW	11	54502611	missense	probably benign	0.03
R6600:Fnip1	UTSW	11	54503099	missense	probably benign
R6882:Fnip1	UTSW	11	54509898	missense	probably damaging	1.00
R6966:Fnip1	UTSW	11	54482559	missense	probably benign	0.00
R7009:Fnip1	UTSW	11	54502935	missense	probably damaging	1.00
R7664:Fnip1	UTSW	11	54466125	missense	probably damaging	1.00
R7706:Fnip1	UTSW	11	54515499	missense	probably benign	0.41
R7866:Fnip1	UTSW	11	54465402	start gained	probably benign
R7939:Fnip1	UTSW	11	54502267	missense	probably damaging	1.00
R7943:Fnip1	UTSW	11	54502388	missense	probably damaging	1.00
R8429:Fnip1	UTSW	11	54475696	missense	possibly damaging	0.94
R8546:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R8753:Fnip1	UTSW	11	54510041	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGGAGATTTGTATGGCGC -3'
(R):5'- CTAGCAATTCCTTAGAGTTGTCTTGAG -3'

Sequencing Primer
(F):5'- ATGGCGCTATTGGATCTCC -3'
(R):5'- CTGTATTTTGCCCAAGGACTG -3'

Posted On

2014-12-04