Mutagenetix > Incidental Mutations

Incidental Mutation 'R2471:Tsc22d1'

253117

Institutional Source

Beutler Lab

Gene Symbol

Tsc22d1

Ensembl Gene

ENSMUSG00000022010

Gene Name

TSC22 domain family, member 1

Synonyms

TSC-22, Tgfb1i4, Egr5

MMRRC Submission

040403-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R2471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76414961-76507765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76418204 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 626 (T626A)

Ref Sequence

ENSEMBL: ENSMUSP00000106513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]

Predicted Effect

probably benign
Transcript: ENSMUST00000048371
AA Change: T708A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: T708A

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	461	489	N/A	INTRINSIC
low complexity region	497	521	N/A	INTRINSIC
low complexity region	537	556	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	673	687	N/A	INTRINSIC
low complexity region	702	724	N/A	INTRINSIC
low complexity region	933	970	N/A	INTRINSIC
Pfam:TSC22	992	1048	7e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110888
AA Change: T626A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: T626A

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	415	439	N/A	INTRINSIC
low complexity region	455	474	N/A	INTRINSIC
internal_repeat_1	502	536	8.43e-5	PROSPERO
low complexity region	537	555	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
internal_repeat_1	644	676	8.43e-5	PROSPERO
low complexity region	851	888	N/A	INTRINSIC
Pfam:TSC22	910	969	4.7e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175984

SMART Domains

Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	77	114	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176581

SMART Domains

Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	78	115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176886

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177333

Predicted Effect

probably benign
Transcript: ENSMUST00000177471

SMART Domains

Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	18	55	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,980,863	M390K	probably benign	Het
Bicra	A	G	7: 15,972,332	S1395P	probably benign	Het
Cacnb2	G	A	2: 14,984,314	D402N	probably damaging	Het
Csmd1	T	A	8: 16,211,762	D907V	probably damaging	Het
Cstl1	T	A	2: 148,751,121	Y65*	probably null	Het
Dnajc1	T	C	2: 18,219,816	I213V	possibly damaging	Het
Emcn	C	T	3: 137,404,011	T138M	probably damaging	Het
F3	G	T	3: 121,725,040	W51L	probably damaging	Het
Far2	A	G	6: 148,138,694	Y41C	probably damaging	Het
Flrt1	A	T	19: 7,096,491	D230E	probably damaging	Het
Gimap7	G	A	6: 48,724,052	V191M	probably damaging	Het
Gm19402	A	T	10: 77,690,520		probably benign	Het
Ipo5	A	C	14: 120,922,162	K134T	probably benign	Het
Kcnf1	T	C	12: 17,175,530	E230G	probably damaging	Het
Mad1l1	T	C	5: 140,261,552	E340G	probably benign	Het
Map4k5	T	C	12: 69,856,846	I62V	probably benign	Het
March7	A	G	2: 60,236,900	K588R	possibly damaging	Het
Mctp2	T	A	7: 72,161,161	K52*	probably null	Het
Nr1h4	A	T	10: 89,473,894	F310L	probably damaging	Het
Ofcc1	G	A	13: 40,097,025	S605F	probably damaging	Het
Olfr1369-ps1	A	T	13: 21,116,429	T246S	probably damaging	Het
Olfr1447	G	A	19: 12,901,315	T155I	probably benign	Het
Olfr209	A	T	16: 59,361,581	S212R	possibly damaging	Het
Pcdh20	T	G	14: 88,467,236	E876A	probably benign	Het
Plce1	C	T	19: 38,779,926	A2215V	probably damaging	Het
Ptprg	T	C	14: 12,210,327	Y128H	probably damaging	Het
Sigirr	A	G	7: 141,092,597	L204S	probably damaging	Het
Slc2a12	A	T	10: 22,664,807	Y187F	probably damaging	Het
Slc31a2	A	T	4: 62,296,075	R86W	probably null	Het
Smc1b	T	C	15: 85,092,017	K830E	probably damaging	Het
Ssrp1	A	G	2: 85,042,298	N427D	possibly damaging	Het
Taar9	A	T	10: 24,109,391	F48L	probably benign	Het
Taok2	T	C	7: 126,875,100	E319G	probably damaging	Het
Try10	T	C	6: 41,356,746	S142P	probably damaging	Het
Zfp101	T	C	17: 33,380,976	E602G	possibly damaging	Het

Other mutations in Tsc22d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Tsc22d1	APN	14	76418917	missense	probably damaging	0.99
IGL00515:Tsc22d1	APN	14	76418477	missense	probably damaging	0.99
IGL00703:Tsc22d1	APN	14	76504828	missense	possibly damaging	0.62
IGL00974:Tsc22d1	APN	14	76506442	missense	probably damaging	1.00
IGL01015:Tsc22d1	APN	14	76418741	missense	possibly damaging	0.66
IGL01515:Tsc22d1	APN	14	76505299	critical splice donor site	probably null
IGL02172:Tsc22d1	APN	14	76417692	missense	probably benign	0.04
IGL02307:Tsc22d1	APN	14	76416461	missense	probably damaging	0.99
IGL02553:Tsc22d1	APN	14	76417398	missense	possibly damaging	0.73
IGL02870:Tsc22d1	APN	14	76417617	missense	probably benign	0.42
IGL02989:Tsc22d1	APN	14	76418901	missense	probably benign	0.05
IGL03216:Tsc22d1	APN	14	76418637	missense	probably benign	0.02
R0127:Tsc22d1	UTSW	14	76418981	missense	possibly damaging	0.92
R0416:Tsc22d1	UTSW	14	76505303	splice site	probably benign
R0854:Tsc22d1	UTSW	14	76418201	nonsense	probably null
R0963:Tsc22d1	UTSW	14	76418599	missense	possibly damaging	0.92
R1370:Tsc22d1	UTSW	14	76437664	intron	probably benign
R1736:Tsc22d1	UTSW	14	76418357	missense	probably benign	0.08
R1751:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R1760:Tsc22d1	UTSW	14	76416948	missense	possibly damaging	0.69
R1767:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R2020:Tsc22d1	UTSW	14	76418333	missense	probably damaging	1.00
R2209:Tsc22d1	UTSW	14	76418740	missense	probably damaging	1.00
R2439:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R3114:Tsc22d1	UTSW	14	76417337	missense	probably damaging	1.00
R3907:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R3973:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3974:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3975:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3976:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R4292:Tsc22d1	UTSW	14	76418880	missense	probably benign	0.12
R4612:Tsc22d1	UTSW	14	76419005	missense	possibly damaging	0.66
R4806:Tsc22d1	UTSW	14	76416988	splice site	probably null
R4980:Tsc22d1	UTSW	14	76418256	missense	probably benign	0.02
R5068:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5070:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5239:Tsc22d1	UTSW	14	76418412	missense	probably damaging	0.99
R5360:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R5400:Tsc22d1	UTSW	14	76417054	missense	probably benign	0.00
R5616:Tsc22d1	UTSW	14	76416217	unclassified	probably benign
R5726:Tsc22d1	UTSW	14	76505317	nonsense	probably null
R5934:Tsc22d1	UTSW	14	76418826	missense	possibly damaging	0.87
R6860:Tsc22d1	UTSW	14	76418292	missense	possibly damaging	0.73
R6904:Tsc22d1	UTSW	14	76506483	nonsense	probably null
R7016:Tsc22d1	UTSW	14	76417542	missense	probably damaging	1.00
R7274:Tsc22d1	UTSW	14	76416714	missense	probably damaging	0.98
R7482:Tsc22d1	UTSW	14	76418487	missense	probably benign	0.10
R7532:Tsc22d1	UTSW	14	76416046	unclassified	probably benign
R7536:Tsc22d1	UTSW	14	76504763	missense	probably benign	0.00
R7784:Tsc22d1	UTSW	14	76416701	nonsense	probably null
R8161:Tsc22d1	UTSW	14	76417020	missense	probably benign	0.02
R8405:Tsc22d1	UTSW	14	76418294	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAGCAACCAATGGTTCC -3'
(R):5'- CTACTTGTGAAGATGGAGGAGC -3'

Sequencing Primer
(F):5'- CAATGGTTCCTGCGCAGATAG -3'
(R):5'- CACCTTGCTGAATAACTGAAGGTG -3'

Posted On

2014-12-04