Mutagenetix > Incidental Mutations

Incidental Mutation 'R2471:Smc1b'

253123

Institutional Source

Beutler Lab

Gene Symbol

Smc1b

Ensembl Gene

ENSMUSG00000022432

Gene Name

structural maintenance of chromosomes 1B

Synonyms

SMC1beta, Smc1l2

MMRRC Submission

040403-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.694) question?

Stock #

R2471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85064689-85131964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85092017 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 830 (K830E)

Ref Sequence

ENSEMBL: ENSMUSP00000023068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023068
AA Change: K830E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: K830E

Domain	Start	End	E-Value	Type
Pfam:AAA_23	7	361	2e-10	PFAM
Pfam:AAA_21	27	372	7.2e-9	PFAM
low complexity region	422	437	N/A	INTRINSIC
SMC_hinge	513	629	1.5e-23	SMART
PDB:1W1W\|D	1046	1218	3e-42	PDB
Blast:AAA	1063	1217	5e-25	BLAST
SCOP:d1e69a_	1114	1202	3e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227591

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,980,863	M390K	probably benign	Het
Bicra	A	G	7: 15,972,332	S1395P	probably benign	Het
Cacnb2	G	A	2: 14,984,314	D402N	probably damaging	Het
Csmd1	T	A	8: 16,211,762	D907V	probably damaging	Het
Cstl1	T	A	2: 148,751,121	Y65*	probably null	Het
Dnajc1	T	C	2: 18,219,816	I213V	possibly damaging	Het
Emcn	C	T	3: 137,404,011	T138M	probably damaging	Het
F3	G	T	3: 121,725,040	W51L	probably damaging	Het
Far2	A	G	6: 148,138,694	Y41C	probably damaging	Het
Flrt1	A	T	19: 7,096,491	D230E	probably damaging	Het
Gimap7	G	A	6: 48,724,052	V191M	probably damaging	Het
Gm19402	A	T	10: 77,690,520		probably benign	Het
Ipo5	A	C	14: 120,922,162	K134T	probably benign	Het
Kcnf1	T	C	12: 17,175,530	E230G	probably damaging	Het
Mad1l1	T	C	5: 140,261,552	E340G	probably benign	Het
Map4k5	T	C	12: 69,856,846	I62V	probably benign	Het
March7	A	G	2: 60,236,900	K588R	possibly damaging	Het
Mctp2	T	A	7: 72,161,161	K52*	probably null	Het
Nr1h4	A	T	10: 89,473,894	F310L	probably damaging	Het
Ofcc1	G	A	13: 40,097,025	S605F	probably damaging	Het
Olfr1369-ps1	A	T	13: 21,116,429	T246S	probably damaging	Het
Olfr1447	G	A	19: 12,901,315	T155I	probably benign	Het
Olfr209	A	T	16: 59,361,581	S212R	possibly damaging	Het
Pcdh20	T	G	14: 88,467,236	E876A	probably benign	Het
Plce1	C	T	19: 38,779,926	A2215V	probably damaging	Het
Ptprg	T	C	14: 12,210,327	Y128H	probably damaging	Het
Sigirr	A	G	7: 141,092,597	L204S	probably damaging	Het
Slc2a12	A	T	10: 22,664,807	Y187F	probably damaging	Het
Slc31a2	A	T	4: 62,296,075	R86W	probably null	Het
Ssrp1	A	G	2: 85,042,298	N427D	possibly damaging	Het
Taar9	A	T	10: 24,109,391	F48L	probably benign	Het
Taok2	T	C	7: 126,875,100	E319G	probably damaging	Het
Try10	T	C	6: 41,356,746	S142P	probably damaging	Het
Tsc22d1	A	G	14: 76,418,204	T626A	probably benign	Het
Zfp101	T	C	17: 33,380,976	E602G	possibly damaging	Het

Other mutations in Smc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00736:Smc1b	APN	15	85129700	missense	possibly damaging	0.95
IGL01293:Smc1b	APN	15	85131898	missense	probably damaging	1.00
IGL01656:Smc1b	APN	15	85114776	missense	probably damaging	0.99
IGL01807:Smc1b	APN	15	85096745	missense	probably damaging	0.97
IGL02094:Smc1b	APN	15	85097891	splice site	probably benign
IGL02121:Smc1b	APN	15	85097985	missense	probably benign
IGL02631:Smc1b	APN	15	85107003	missense	probably damaging	0.98
IGL02678:Smc1b	APN	15	85065000	nonsense	probably null
IGL03197:Smc1b	APN	15	85070863	missense	possibly damaging	0.85
IGL03214:Smc1b	APN	15	85097946	nonsense	probably null
IGL03218:Smc1b	APN	15	85089713	missense	probably benign	0.07
IGL03232:Smc1b	APN	15	85129720	missense	possibly damaging	0.68
adamantine	UTSW	15	85121641	missense	probably benign	0.06
unbreakable	UTSW	15	85096658	missense	probably benign
E0370:Smc1b	UTSW	15	85127581	missense	probably damaging	1.00
PIT4812001:Smc1b	UTSW	15	85069651	missense	possibly damaging	0.91
R0092:Smc1b	UTSW	15	85067724	unclassified	probably benign
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0207:Smc1b	UTSW	15	85123759	missense	probably benign
R0390:Smc1b	UTSW	15	85066277	missense	probably damaging	1.00
R0440:Smc1b	UTSW	15	85112673	splice site	probably benign
R0685:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R1109:Smc1b	UTSW	15	85112815	missense	probably damaging	0.98
R1392:Smc1b	UTSW	15	85107070	splice site	probably benign
R1509:Smc1b	UTSW	15	85086134	missense	probably benign
R1804:Smc1b	UTSW	15	85127790	missense	possibly damaging	0.90
R1879:Smc1b	UTSW	15	85092067	missense	probably benign	0.01
R2086:Smc1b	UTSW	15	85121851	splice site	probably benign
R2143:Smc1b	UTSW	15	85123802	missense	probably benign
R2158:Smc1b	UTSW	15	85121851	splice site	probably benign
R2174:Smc1b	UTSW	15	85121851	splice site	probably benign
R3689:Smc1b	UTSW	15	85117263	intron	probably benign
R3690:Smc1b	UTSW	15	85117263	intron	probably benign
R4178:Smc1b	UTSW	15	85120647	missense	possibly damaging	0.94
R4420:Smc1b	UTSW	15	85112830	missense	probably damaging	1.00
R4905:Smc1b	UTSW	15	85066227	missense	probably damaging	1.00
R4919:Smc1b	UTSW	15	85117104	intron	probably benign
R5114:Smc1b	UTSW	15	85064984	missense	probably damaging	1.00
R5314:Smc1b	UTSW	15	85070865	missense	probably benign	0.00
R5476:Smc1b	UTSW	15	85086151	missense	probably damaging	0.97
R5593:Smc1b	UTSW	15	85121641	missense	probably benign	0.06
R5690:Smc1b	UTSW	15	85112773	missense	probably damaging	1.00
R5719:Smc1b	UTSW	15	85096658	missense	probably benign
R5817:Smc1b	UTSW	15	85067783	missense	probably damaging	0.99
R5834:Smc1b	UTSW	15	85089665	missense	probably damaging	1.00
R5930:Smc1b	UTSW	15	85086121	missense	probably damaging	1.00
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6049:Smc1b	UTSW	15	85121695	missense	probably damaging	1.00
R6306:Smc1b	UTSW	15	85127623	missense	probably benign	0.30
R6392:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6426:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6435:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6436:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6437:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6508:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6512:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6703:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6737:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6775:Smc1b	UTSW	15	85089680	missense	probably damaging	0.96
R6889:Smc1b	UTSW	15	85067759	missense	probably damaging	1.00
R6908:Smc1b	UTSW	15	85107010	missense	probably damaging	1.00
R7124:Smc1b	UTSW	15	85071597	missense	probably damaging	0.98
R7400:Smc1b	UTSW	15	85069720	missense	probably damaging	1.00
R7417:Smc1b	UTSW	15	85097542	missense	probably benign	0.05
R7610:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R7873:Smc1b	UTSW	15	85110650	critical splice donor site	probably null
R7890:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8004:Smc1b	UTSW	15	85097614	missense	probably damaging	0.98
Z1176:Smc1b	UTSW	15	85131903	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATCACAATAAGGCACCATTGGG -3'
(R):5'- GGCAATGGCAGTGATTATATTAAGG -3'

Sequencing Primer
(F):5'- AACTGGCACTTCAGCTAC -3'
(R):5'- CAGAGAACACTTACTGCTCTTGGAG -3'

Posted On

2014-12-04