Mutagenetix > Incidental Mutations

Incidental Mutation 'R2471:Olfr209'

253126

Institutional Source

Beutler Lab

Gene Symbol

Olfr209

Ensembl Gene

ENSMUSG00000095706

Gene Name

olfactory receptor 209

Synonyms

MOR182-6, GA_x54KRFPKG5P-55590495-55589578

MMRRC Submission

040403-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R2471 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59361160-59363993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59361581 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 212 (S212R)

Ref Sequence

ENSEMBL: ENSMUSP00000147068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055868] [ENSMUST00000208246] [ENSMUST00000208875] [ENSMUST00000213779]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055868
AA Change: S212R

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000053192
Gene: ENSMUSG00000095706
AA Change: S212R

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	304	1.3e-49	PFAM
Pfam:7TM_GPCR_Srsx	34	303	1.3e-6	PFAM
Pfam:7tm_1	40	289	6.2e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000208246

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208875
AA Change: S212R

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000213779

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,980,863	M390K	probably benign	Het
Bicra	A	G	7: 15,972,332	S1395P	probably benign	Het
Cacnb2	G	A	2: 14,984,314	D402N	probably damaging	Het
Csmd1	T	A	8: 16,211,762	D907V	probably damaging	Het
Cstl1	T	A	2: 148,751,121	Y65*	probably null	Het
Dnajc1	T	C	2: 18,219,816	I213V	possibly damaging	Het
Emcn	C	T	3: 137,404,011	T138M	probably damaging	Het
F3	G	T	3: 121,725,040	W51L	probably damaging	Het
Far2	A	G	6: 148,138,694	Y41C	probably damaging	Het
Flrt1	A	T	19: 7,096,491	D230E	probably damaging	Het
Gimap7	G	A	6: 48,724,052	V191M	probably damaging	Het
Gm19402	A	T	10: 77,690,520		probably benign	Het
Ipo5	A	C	14: 120,922,162	K134T	probably benign	Het
Kcnf1	T	C	12: 17,175,530	E230G	probably damaging	Het
Mad1l1	T	C	5: 140,261,552	E340G	probably benign	Het
Map4k5	T	C	12: 69,856,846	I62V	probably benign	Het
March7	A	G	2: 60,236,900	K588R	possibly damaging	Het
Mctp2	T	A	7: 72,161,161	K52*	probably null	Het
Nr1h4	A	T	10: 89,473,894	F310L	probably damaging	Het
Ofcc1	G	A	13: 40,097,025	S605F	probably damaging	Het
Olfr1369-ps1	A	T	13: 21,116,429	T246S	probably damaging	Het
Olfr1447	G	A	19: 12,901,315	T155I	probably benign	Het
Pcdh20	T	G	14: 88,467,236	E876A	probably benign	Het
Plce1	C	T	19: 38,779,926	A2215V	probably damaging	Het
Ptprg	T	C	14: 12,210,327	Y128H	probably damaging	Het
Sigirr	A	G	7: 141,092,597	L204S	probably damaging	Het
Slc2a12	A	T	10: 22,664,807	Y187F	probably damaging	Het
Slc31a2	A	T	4: 62,296,075	R86W	probably null	Het
Smc1b	T	C	15: 85,092,017	K830E	probably damaging	Het
Ssrp1	A	G	2: 85,042,298	N427D	possibly damaging	Het
Taar9	A	T	10: 24,109,391	F48L	probably benign	Het
Taok2	T	C	7: 126,875,100	E319G	probably damaging	Het
Try10	T	C	6: 41,356,746	S142P	probably damaging	Het
Tsc22d1	A	G	14: 76,418,204	T626A	probably benign	Het
Zfp101	T	C	17: 33,380,976	E602G	possibly damaging	Het

Other mutations in Olfr209

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01083:Olfr209	APN	16	59361835	missense	probably damaging	1.00
IGL01137:Olfr209	APN	16	59361972	missense	probably benign	0.01
IGL01383:Olfr209	APN	16	59361953	missense	probably benign	0.10
IGL01913:Olfr209	APN	16	59361931	missense	probably damaging	1.00
IGL01914:Olfr209	APN	16	59361931	missense	probably damaging	1.00
IGL02125:Olfr209	APN	16	59361516	missense	probably benign
IGL02414:Olfr209	APN	16	59361714	missense	probably damaging	1.00
IGL02512:Olfr209	APN	16	59361808	missense	possibly damaging	0.95
PIT4495001:Olfr209	UTSW	16	59361508	missense	probably damaging	0.99
R0029:Olfr209	UTSW	16	59361541	missense	probably benign	0.00
R0531:Olfr209	UTSW	16	59361808	missense	probably damaging	0.99
R1799:Olfr209	UTSW	16	59361880	missense	probably benign	0.01
R1901:Olfr209	UTSW	16	59362163	missense	probably benign	0.03
R1902:Olfr209	UTSW	16	59362163	missense	probably benign	0.03
R1903:Olfr209	UTSW	16	59362163	missense	probably benign	0.03
R1972:Olfr209	UTSW	16	59362113	missense	probably damaging	0.96
R5013:Olfr209	UTSW	16	59361704	missense	probably damaging	1.00
R5160:Olfr209	UTSW	16	59361766	missense	probably damaging	1.00
R5883:Olfr209	UTSW	16	59361715	missense	probably damaging	1.00
R6272:Olfr209	UTSW	16	59361585	missense	possibly damaging	0.76
R6296:Olfr209	UTSW	16	59361406	missense	probably benign	0.06
R6741:Olfr209	UTSW	16	59361555	missense	probably damaging	1.00
R6928:Olfr209	UTSW	16	59361463	missense	probably damaging	1.00
R7982:Olfr209	UTSW	16	59361564	missense	probably benign
R8254:Olfr209	UTSW	16	59362171	missense	probably benign	0.00
R8429:Olfr209	UTSW	16	59361627	missense	possibly damaging	0.89
X0017:Olfr209	UTSW	16	59361639	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCTGATAATTATCTTTGTCAGAGCC -3'
(R):5'- TGGTGATGTCCAACAGACTC -3'

Sequencing Primer
(F):5'- TTATCTTTGTCAGAGCCAGAGAGGAC -3'
(R):5'- GGTGATGTCCAACAGACTCTGTATTC -3'

Posted On

2014-12-04