Incidental Mutation 'R2471:Olfr209'
ID253126
Institutional Source Beutler Lab
Gene Symbol Olfr209
Ensembl Gene ENSMUSG00000095706
Gene Nameolfactory receptor 209
SynonymsMOR182-6, GA_x54KRFPKG5P-55590495-55589578
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59361160-59363993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59361581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 212 (S212R)
Ref Sequence ENSEMBL: ENSMUSP00000147068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055868] [ENSMUST00000208246] [ENSMUST00000208875] [ENSMUST00000213779]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055868
AA Change: S212R

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053192
Gene: ENSMUSG00000095706
AA Change: S212R

DomainStartEndE-ValueType
Pfam:7tm_4 30 304 1.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 303 1.3e-6 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208246
Predicted Effect possibly damaging
Transcript: ENSMUST00000208875
AA Change: S212R

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000213779
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Olfr209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Olfr209 APN 16 59361835 missense probably damaging 1.00
IGL01137:Olfr209 APN 16 59361972 missense probably benign 0.01
IGL01383:Olfr209 APN 16 59361953 missense probably benign 0.10
IGL01913:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL01914:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL02125:Olfr209 APN 16 59361516 missense probably benign
IGL02414:Olfr209 APN 16 59361714 missense probably damaging 1.00
IGL02512:Olfr209 APN 16 59361808 missense possibly damaging 0.95
PIT4495001:Olfr209 UTSW 16 59361508 missense probably damaging 0.99
R0029:Olfr209 UTSW 16 59361541 missense probably benign 0.00
R0531:Olfr209 UTSW 16 59361808 missense probably damaging 0.99
R1799:Olfr209 UTSW 16 59361880 missense probably benign 0.01
R1901:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1902:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1903:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1972:Olfr209 UTSW 16 59362113 missense probably damaging 0.96
R5013:Olfr209 UTSW 16 59361704 missense probably damaging 1.00
R5160:Olfr209 UTSW 16 59361766 missense probably damaging 1.00
R5883:Olfr209 UTSW 16 59361715 missense probably damaging 1.00
R6272:Olfr209 UTSW 16 59361585 missense possibly damaging 0.76
R6296:Olfr209 UTSW 16 59361406 missense probably benign 0.06
R6741:Olfr209 UTSW 16 59361555 missense probably damaging 1.00
R6928:Olfr209 UTSW 16 59361463 missense probably damaging 1.00
R7982:Olfr209 UTSW 16 59361564 missense probably benign
R8254:Olfr209 UTSW 16 59362171 missense probably benign 0.00
R8429:Olfr209 UTSW 16 59361627 missense possibly damaging 0.89
X0017:Olfr209 UTSW 16 59361639 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTGATAATTATCTTTGTCAGAGCC -3'
(R):5'- TGGTGATGTCCAACAGACTC -3'

Sequencing Primer
(F):5'- TTATCTTTGTCAGAGCCAGAGAGGAC -3'
(R):5'- GGTGATGTCCAACAGACTCTGTATTC -3'
Posted On2014-12-04