Incidental Mutation 'R2471:Zfp101'
ID253128
Institutional Source Beutler Lab
Gene Symbol Zfp101
Ensembl Gene ENSMUSG00000055240
Gene Namezinc finger protein 101
Synonyms
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33360507-33394641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33380976 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 602 (E602G)
Ref Sequence ENSEMBL: ENSMUSP00000132508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167107] [ENSMUST00000174417] [ENSMUST00000174512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167107
AA Change: E602G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132508
Gene: ENSMUSG00000055240
AA Change: E602G

DomainStartEndE-ValueType
KRAB 10 62 9.34e-15 SMART
ZnF_C2H2 219 241 2.57e-3 SMART
ZnF_C2H2 247 269 6.32e-3 SMART
ZnF_C2H2 275 297 3.16e-3 SMART
ZnF_C2H2 302 322 1.65e2 SMART
ZnF_C2H2 330 352 6.75e0 SMART
ZnF_C2H2 358 380 2.75e-3 SMART
ZnF_C2H2 386 408 4.47e-3 SMART
ZnF_C2H2 414 436 2.09e-3 SMART
ZnF_C2H2 442 464 4.79e-3 SMART
ZnF_C2H2 470 492 2.2e-2 SMART
ZnF_C2H2 498 520 4.47e-3 SMART
ZnF_C2H2 526 548 4.72e-2 SMART
ZnF_C2H2 554 576 1.28e-3 SMART
ZnF_C2H2 583 605 5.06e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173151
Predicted Effect probably benign
Transcript: ENSMUST00000174417
SMART Domains Protein: ENSMUSP00000134459
Gene: ENSMUSG00000055240

DomainStartEndE-ValueType
Blast:KRAB 1 38 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174512
SMART Domains Protein: ENSMUSP00000133873
Gene: ENSMUSG00000055240

DomainStartEndE-ValueType
KRAB 10 62 9.34e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183047
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Other mutations in Zfp101
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0189:Zfp101 UTSW 17 33382239 missense possibly damaging 0.53
R0254:Zfp101 UTSW 17 33380978 missense possibly damaging 0.71
R0448:Zfp101 UTSW 17 33382321 missense possibly damaging 0.73
R0696:Zfp101 UTSW 17 33381427 missense possibly damaging 0.86
R0834:Zfp101 UTSW 17 33382444 missense probably benign 0.33
R2000:Zfp101 UTSW 17 33381517 missense possibly damaging 0.92
R2366:Zfp101 UTSW 17 33380998 missense probably benign 0.06
R3713:Zfp101 UTSW 17 33381906 missense probably benign 0.05
R3857:Zfp101 UTSW 17 33382431 nonsense probably null
R4537:Zfp101 UTSW 17 33382492 missense possibly damaging 0.87
R4712:Zfp101 UTSW 17 33394483 splice site probably null
R5049:Zfp101 UTSW 17 33381898 missense possibly damaging 0.71
R5241:Zfp101 UTSW 17 33382236 missense probably benign
R5499:Zfp101 UTSW 17 33382344 missense probably benign 0.20
R5587:Zfp101 UTSW 17 33381321 missense possibly damaging 0.71
R5694:Zfp101 UTSW 17 33380945 missense probably benign
R5994:Zfp101 UTSW 17 33380962 missense probably benign
R6193:Zfp101 UTSW 17 33381746 nonsense probably null
R7331:Zfp101 UTSW 17 33382585 missense possibly damaging 0.53
R7393:Zfp101 UTSW 17 33386700 missense possibly damaging 0.71
R7434:Zfp101 UTSW 17 33381590 missense possibly damaging 0.86
R7922:Zfp101 UTSW 17 33381537 missense possibly damaging 0.93
R8087:Zfp101 UTSW 17 33381003 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTAAAATTACATTTTGCTGGTC -3'
(R):5'- ACCACTTCCAGTACCCGTAA -3'

Sequencing Primer
(F):5'- ATGACTAGCTAAGCTATCTCGCGTG -3'
(R):5'- TTCCAGTACCCGTAACAGTCATG -3'
Posted On2014-12-04