Incidental Mutation 'R2471:Flrt1'
ID253129
Institutional Source Beutler Lab
Gene Symbol Flrt1
Ensembl Gene ENSMUSG00000047787
Gene Namefibronectin leucine rich transmembrane protein 1
SynonymsD630040I23Rik
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7092014-7105729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7096491 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 230 (D230E)
Ref Sequence ENSEMBL: ENSMUSP00000109010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040261] [ENSMUST00000113383]
Predicted Effect probably benign
Transcript: ENSMUST00000040261
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113383
AA Change: D230E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109010
Gene: ENSMUSG00000047787
AA Change: D230E

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRRNT 53 85 4.11e-6 SMART
LRR 127 149 2.61e1 SMART
LRR 150 175 4.71e1 SMART
LRR 177 199 1.76e1 SMART
LRR 200 220 7.36e0 SMART
LRR 221 246 1.49e1 SMART
LRR 247 270 9.77e1 SMART
LRR 271 292 1.53e1 SMART
LRR_TYP 293 316 3.55e-6 SMART
LRRCT 328 379 5.19e-9 SMART
low complexity region 381 392 N/A INTRINSIC
FN3 434 515 1.49e0 SMART
transmembrane domain 556 578 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. The family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. The encoded protein shares sequence similarity with two other family members, FLRT2 and FLRT3. This gene is expressed in kidney and brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Flrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Flrt1 APN 19 7096912 missense probably damaging 1.00
IGL01082:Flrt1 APN 19 7095974 missense probably benign
IGL02535:Flrt1 APN 19 7096733 missense probably benign 0.00
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0403:Flrt1 UTSW 19 7095919 missense probably benign 0.01
R0645:Flrt1 UTSW 19 7097143 intron probably benign
R0677:Flrt1 UTSW 19 7096179 nonsense probably null
R1818:Flrt1 UTSW 19 7095346 missense probably damaging 1.00
R2191:Flrt1 UTSW 19 7095829 missense probably damaging 0.99
R2228:Flrt1 UTSW 19 7095358 missense probably damaging 1.00
R4978:Flrt1 UTSW 19 7096876 missense probably damaging 1.00
R5460:Flrt1 UTSW 19 7095740 missense probably damaging 0.99
R5630:Flrt1 UTSW 19 7096465 missense probably damaging 1.00
R6326:Flrt1 UTSW 19 7096609 missense probably damaging 1.00
R6734:Flrt1 UTSW 19 7096159 missense possibly damaging 0.91
R6905:Flrt1 UTSW 19 7095392 nonsense probably null
R7239:Flrt1 UTSW 19 7095964 missense probably benign 0.12
R7799:Flrt1 UTSW 19 7095864 missense possibly damaging 0.78
R8168:Flrt1 UTSW 19 7096637 missense probably damaging 1.00
X0024:Flrt1 UTSW 19 7095749 missense probably damaging 1.00
X0062:Flrt1 UTSW 19 7096879 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCCAGGTCATCAAACAGG -3'
(R):5'- TTTCCACCGTGAGCATCGAG -3'

Sequencing Primer
(F):5'- GGTCATCAAACAGGCCCCG -3'
(R):5'- CCGTGAGCATCGAGGAGGATG -3'
Posted On2014-12-04