Incidental Mutation 'R0313:Ssrp1'
ID25313
Institutional Source Beutler Lab
Gene Symbol Ssrp1
Ensembl Gene ENSMUSG00000027067
Gene Namestructure specific recognition protein 1
SynonymsHmgi-rs3, T160, Hmgox, Hmg1-rs1
MMRRC Submission 038523-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0313 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85037234-85047109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85041554 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 374 (I374N)
Ref Sequence ENSEMBL: ENSMUSP00000121639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077798] [ENSMUST00000111613] [ENSMUST00000130729] [ENSMUST00000168266]
Predicted Effect probably damaging
Transcript: ENSMUST00000077798
AA Change: I374N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076971
Gene: ENSMUSG00000027067
AA Change: I374N

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 1.7e-105 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111613
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127069
Predicted Effect probably damaging
Transcript: ENSMUST00000130729
AA Change: I374N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121639
Gene: ENSMUSG00000027067
AA Change: I374N

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 5.7e-106 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146530
Predicted Effect probably damaging
Transcript: ENSMUST00000168266
AA Change: I374N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127058
Gene: ENSMUSG00000027067
AA Change: I374N

DomainStartEndE-ValueType
Pfam:SSrecog 75 284 8.8e-91 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.9%
  • 20x: 88.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of a heterodimer that, along with SUPT16H, forms chromatin transcriptional elongation factor FACT. FACT interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. This encoded protein contains a high mobility group box which most likely constitutes the structure recognition element for cisplatin-modified DNA. This protein also functions as a co-activator of the transcriptional activator p63. An alternatively spliced transcript variant of this gene has been described, but its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene is lethal resulting in death at some point between implantation and E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,672,097 E309G probably benign Het
AI314180 A G 4: 58,811,892 I1411T probably benign Het
Ankmy1 C T 1: 92,886,221 G412D probably damaging Het
Cc2d1a G A 8: 84,136,969 T542I probably benign Het
Cldn18 T C 9: 99,698,914 I94V probably benign Het
Cobll1 G A 2: 65,095,744 R1195* probably null Het
Dnah7b A G 1: 46,207,643 T1660A probably damaging Het
Dzip3 G T 16: 48,937,061 Q870K probably damaging Het
Ebf4 T C 2: 130,306,787 probably benign Het
Esyt2 T C 12: 116,347,808 L439P probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Haspin A G 11: 73,136,298 V655A probably damaging Het
Kmt2c T C 5: 25,344,930 E1351G probably damaging Het
Lama2 C A 10: 26,993,398 probably null Het
Lcp1 A G 14: 75,199,433 E73G probably damaging Het
Ltv1 C T 10: 13,182,860 probably null Het
Mcmdc2 A G 1: 9,932,141 Y529C probably damaging Het
Myo3b T A 2: 70,348,959 Y1172* probably null Het
Ncf1 T C 5: 134,229,567 M1V probably null Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr250 T C 9: 38,368,304 S243P probably damaging Het
Olfr765 A G 10: 129,046,826 V79A possibly damaging Het
Pcif1 A T 2: 164,884,419 H80L probably damaging Het
Pclo T C 5: 14,678,873 probably benign Het
Polr2a T C 11: 69,735,080 Y1710C unknown Het
Ppp1r37 G A 7: 19,533,998 T324I probably damaging Het
Prmt1 T C 7: 44,978,748 D176G probably benign Het
Scn5a T C 9: 119,534,571 D501G probably damaging Het
Ska2 A G 11: 87,117,814 I89M possibly damaging Het
Slc39a7 G A 17: 34,029,544 A375V probably damaging Het
Stox2 C T 8: 47,192,134 G828R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Uqcrc1 C A 9: 108,948,574 R114S possibly damaging Het
Usp38 A T 8: 80,984,442 L988* probably null Het
Vmn2r5 T A 3: 64,503,827 H440L probably benign Het
Wdr12 A T 1: 60,082,579 I271N possibly damaging Het
Xylt2 C T 11: 94,669,894 probably benign Het
Other mutations in Ssrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ssrp1 APN 2 85041099 splice site probably benign
IGL01935:Ssrp1 APN 2 85046712 makesense probably null
IGL02226:Ssrp1 APN 2 85040361 missense probably damaging 1.00
IGL02793:Ssrp1 APN 2 85040920 missense probably damaging 1.00
IGL02875:Ssrp1 APN 2 85040920 missense probably damaging 1.00
Dickcissel UTSW 2 85041634 missense probably damaging 0.96
Meadowlark UTSW 2 85041106 critical splice acceptor site probably null
PIT4131001:Ssrp1 UTSW 2 85038416 missense probably damaging 1.00
R0363:Ssrp1 UTSW 2 85040674 missense probably damaging 0.99
R1234:Ssrp1 UTSW 2 85042263 missense probably damaging 1.00
R1643:Ssrp1 UTSW 2 85041185 missense possibly damaging 0.89
R1713:Ssrp1 UTSW 2 85040760 missense probably damaging 0.99
R2049:Ssrp1 UTSW 2 85041427 splice site probably benign
R2113:Ssrp1 UTSW 2 85043006 splice site probably null
R2291:Ssrp1 UTSW 2 85042316 critical splice donor site probably null
R2471:Ssrp1 UTSW 2 85042298 missense possibly damaging 0.95
R2965:Ssrp1 UTSW 2 85041586 missense possibly damaging 0.46
R3552:Ssrp1 UTSW 2 85044392 missense probably benign
R4060:Ssrp1 UTSW 2 85041634 missense probably damaging 0.96
R4075:Ssrp1 UTSW 2 85045568 missense possibly damaging 0.68
R4131:Ssrp1 UTSW 2 85044447 missense probably null 0.28
R4326:Ssrp1 UTSW 2 85040217 intron probably benign
R4357:Ssrp1 UTSW 2 85041151 missense probably benign 0.22
R4400:Ssrp1 UTSW 2 85037941 missense probably damaging 0.97
R4797:Ssrp1 UTSW 2 85045722 nonsense probably null
R5293:Ssrp1 UTSW 2 85042252 nonsense probably null
R5571:Ssrp1 UTSW 2 85044325 missense probably damaging 0.99
R5592:Ssrp1 UTSW 2 85045519 missense probably benign 0.00
R5743:Ssrp1 UTSW 2 85041168 nonsense probably null
R5991:Ssrp1 UTSW 2 85042296 missense possibly damaging 0.94
R6019:Ssrp1 UTSW 2 85045452 missense probably damaging 1.00
R6133:Ssrp1 UTSW 2 85045339 intron probably benign
R6157:Ssrp1 UTSW 2 85040728 missense probably damaging 0.99
R6225:Ssrp1 UTSW 2 85042814 missense probably benign 0.02
R6551:Ssrp1 UTSW 2 85041106 critical splice acceptor site probably null
R6886:Ssrp1 UTSW 2 85039936 missense probably benign 0.04
R7189:Ssrp1 UTSW 2 85045562 missense probably benign 0.00
R7681:Ssrp1 UTSW 2 85045748 missense probably benign
R7789:Ssrp1 UTSW 2 85041181 missense probably damaging 1.00
X0023:Ssrp1 UTSW 2 85045475 missense probably benign 0.06
Z1088:Ssrp1 UTSW 2 85040653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGACAAGGCTTCCTGCATC -3'
(R):5'- GCCAGCAGACGTATAGCTAGTCAC -3'

Sequencing Primer
(F):5'- TGCATCCTCCACCAGGC -3'
(R):5'- gcgtttaatcccagcactc -3'
Posted On2013-04-16