Incidental Mutation 'R2472:Crispld1'
ID 253137
Institutional Source Beutler Lab
Gene Symbol Crispld1
Ensembl Gene ENSMUSG00000025776
Gene Name cysteine-rich secretory protein LCCL domain containing 1
Synonyms Cocoacrisp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R2472 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 17727045-17766344 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 17745828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 142 (R142S)
Ref Sequence ENSEMBL: ENSMUSP00000123800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095075] [ENSMUST00000159958] [ENSMUST00000160305]
AlphaFold Q8CGD2
Predicted Effect probably benign
Transcript: ENSMUST00000095075
AA Change: R142S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092686
Gene: ENSMUSG00000025776
AA Change: R142S

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159958
AA Change: R142S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124095
Gene: ENSMUSG00000025776
AA Change: R142S

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160305
AA Change: R142S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123800
Gene: ENSMUSG00000025776
AA Change: R142S

DomainStartEndE-ValueType
SCP 60 162 1.26e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189853
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,506,252 S291P probably damaging Het
Cbln3 T C 14: 55,884,081 E36G possibly damaging Het
Cdcp1 A G 9: 123,185,107 F201L probably benign Het
Dsc2 T A 18: 20,045,469 M293L probably benign Het
Dzip3 A T 16: 48,953,787 S362T possibly damaging Het
Grm4 C T 17: 27,434,675 C512Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L1td1 C T 4: 98,733,159 probably benign Het
Nav2 A G 7: 49,408,884 T252A probably benign Het
Neu3 A C 7: 99,813,407 S370A probably damaging Het
Nfasc T A 1: 132,588,221 probably benign Het
Olfr1394 T C 11: 49,160,371 V119A possibly damaging Het
Ptk7 T C 17: 46,576,848 T553A probably benign Het
Rap2a T C 14: 120,478,833 I36T possibly damaging Het
Rinl A C 7: 28,790,378 D7A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16a T C 2: 26,439,936 E689G probably damaging Het
Sec31a T C 5: 100,385,205 I560M probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Setdb2 G A 14: 59,419,454 T138I possibly damaging Het
Sgsh G T 11: 119,355,474 P4Q possibly damaging Het
Slco4a1 G T 2: 180,467,087 W308L probably damaging Het
Ttn T A 2: 76,781,519 R17346S possibly damaging Het
Ubxn4 A G 1: 128,272,869 R366G probably damaging Het
Vmn2r90 T G 17: 17,728,146 N551K probably damaging Het
Other mutations in Crispld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Crispld1 APN 1 17746801 missense probably benign 0.21
IGL01610:Crispld1 APN 1 17746725 splice site probably null
IGL01991:Crispld1 APN 1 17753017 missense probably benign
IGL02004:Crispld1 APN 1 17747520 missense probably damaging 1.00
IGL02178:Crispld1 APN 1 17762103 splice site probably benign
IGL02200:Crispld1 APN 1 17750333 unclassified probably benign
IGL02251:Crispld1 APN 1 17728840 missense probably benign 0.06
IGL02506:Crispld1 APN 1 17756305 missense probably damaging 0.99
IGL02883:Crispld1 APN 1 17746789 missense possibly damaging 0.87
IGL03310:Crispld1 APN 1 17745477 splice site probably benign
milliliter UTSW 1 17750801 missense possibly damaging 0.81
Spoonful UTSW 1 17762141 missense probably damaging 1.00
R0068:Crispld1 UTSW 1 17752988 missense possibly damaging 0.89
R0324:Crispld1 UTSW 1 17749591 missense probably benign
R0542:Crispld1 UTSW 1 17746768 missense possibly damaging 0.75
R1117:Crispld1 UTSW 1 17749622 missense probably benign 0.03
R1157:Crispld1 UTSW 1 17745363 missense possibly damaging 0.70
R1585:Crispld1 UTSW 1 17750800 missense possibly damaging 0.68
R1630:Crispld1 UTSW 1 17728798 missense probably benign
R2081:Crispld1 UTSW 1 17762179 missense probably damaging 0.99
R2143:Crispld1 UTSW 1 17749636 missense probably benign
R2520:Crispld1 UTSW 1 17750776 missense probably damaging 1.00
R4476:Crispld1 UTSW 1 17747510 missense probably damaging 1.00
R4486:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R4779:Crispld1 UTSW 1 17749607 missense probably benign
R5508:Crispld1 UTSW 1 17752983 missense probably damaging 1.00
R5568:Crispld1 UTSW 1 17750271 missense probably benign 0.01
R6155:Crispld1 UTSW 1 17753017 missense probably benign
R6252:Crispld1 UTSW 1 17749507 missense probably benign 0.00
R6361:Crispld1 UTSW 1 17762231 missense probably damaging 0.99
R6617:Crispld1 UTSW 1 17728662 missense probably benign 0.02
R6760:Crispld1 UTSW 1 17750801 missense possibly damaging 0.81
R6961:Crispld1 UTSW 1 17762141 missense probably damaging 1.00
R7278:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R7403:Crispld1 UTSW 1 17747596 missense probably damaging 1.00
R7592:Crispld1 UTSW 1 17728766 missense possibly damaging 0.64
R7837:Crispld1 UTSW 1 17728730 missense probably benign 0.42
R8906:Crispld1 UTSW 1 17750771 missense possibly damaging 0.95
R9331:Crispld1 UTSW 1 17762230 missense probably damaging 0.99
R9477:Crispld1 UTSW 1 17746732 missense probably benign 0.44
Z1088:Crispld1 UTSW 1 17764076 missense probably benign
Z1176:Crispld1 UTSW 1 17728613 start gained probably benign
Z1176:Crispld1 UTSW 1 17752851 missense possibly damaging 0.60
Z1177:Crispld1 UTSW 1 17764092 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGATTCACCAATTCCCTAGCCTG -3'
(R):5'- GCCTATTCCAAGGAATTAACAATGC -3'

Sequencing Primer
(F):5'- ACCAATTCCCTAGCCTGTTTTTG -3'
(R):5'- TTCCAAGGAATTAACAATGCTACAC -3'
Posted On 2014-12-04