Mutagenetix > Incidental Mutations

Incidental Mutation 'R2865:Slc12a6'

253142

Institutional Source

Beutler Lab

Gene Symbol

Slc12a6

Ensembl Gene

ENSMUSG00000027130

Gene Name

solute carrier family 12, member 6

Synonyms

gaxp, KCC3

MMRRC Submission

040454-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R2865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112265825-112363163 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 112347317 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 594 (V594I)

Ref Sequence

ENSEMBL: ENSMUSP00000124314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]

Predicted Effect

probably benign
Transcript: ENSMUST00000028549
AA Change: V609I

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: V609I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	8e-3	SMART
Pfam:AA_permease	190	384	4.1e-25	PFAM
Pfam:AA_permease	453	761	2.3e-43	PFAM
Pfam:SLC12	773	897	7.1e-20	PFAM
Pfam:SLC12	892	1150	3.9e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000053666
AA Change: V558I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130
AA Change: V558I

Domain	Start	End	E-Value	Type
Pfam:AA_permease	139	333	2.3e-25	PFAM
Pfam:AA_permease_2	385	668	1.5e-19	PFAM
Pfam:AA_permease	391	710	4.5e-41	PFAM
low complexity region	828	842	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	967	996	2.2e-23	PFAM
low complexity region	1079	1091	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110987
AA Change: V594I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: V594I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	4e-3	SMART
Pfam:AA_permease	175	369	3.9e-25	PFAM
Pfam:AA_permease_2	421	704	3.2e-19	PFAM
Pfam:AA_permease	426	746	5.8e-41	PFAM
low complexity region	864	878	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110991
AA Change: V609I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: V609I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	7e-3	SMART
Pfam:AA_permease	190	384	4.2e-25	PFAM
Pfam:AA_permease_2	436	719	2.9e-19	PFAM
Pfam:AA_permease	442	761	8.2e-41	PFAM
low complexity region	879	893	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	1018	1047	2.7e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133840

Predicted Effect

probably benign
Transcript: ENSMUST00000141047
AA Change: V594I

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: V594I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	8e-3	SMART
Pfam:AA_permease	175	369	6.6e-25	PFAM
Pfam:AA_permease	438	746	3.6e-43	PFAM
Pfam:SLC12	758	884	6.8e-20	PFAM
Pfam:SLC12	877	1033	5.9e-20	PFAM

Meta Mutation Damage Score

0.2974

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	A	G	8: 12,279,635	Q30R	unknown	Het
Bmper	A	G	9: 23,483,941	N656S	probably benign	Het
Cic	T	A	7: 25,273,221	D792E	probably damaging	Het
Dab1	G	A	4: 104,680,146	C192Y	probably benign	Het
Ddx6	G	T	9: 44,614,256	L103F	probably damaging	Het
Fhod1	T	C	8: 105,332,911	K714R	probably null	Het
Flt1	T	C	5: 147,594,621	Q844R	possibly damaging	Het
Fnip1	T	C	11: 54,502,424	I562T	probably damaging	Het
Fxr2	T	A	11: 69,639,427	I40N	probably damaging	Het
Gm5065	G	T	7: 5,359,669	D100Y	probably benign	Het
Gm7168	A	G	17: 13,949,855	K495E	probably benign	Het
Gria2	C	T	3: 80,732,085	V207I	probably benign	Het
Ifna6	G	C	4: 88,827,862	R149S	probably benign	Het
Ifna6	C	A	4: 88,827,849	T145K	probably benign	Het
Igf2r	T	C	17: 12,686,724	H2240R	probably damaging	Het
Ighv8-9	G	A	12: 115,468,446	P82S	probably benign	Het
Itpr3	T	C	17: 27,091,551	V436A	probably benign	Het
Ldb3	T	G	14: 34,529,503	D609A	probably damaging	Het
Luc7l	C	A	17: 26,266,361	Q112K	probably damaging	Het
March4	C	T	1: 72,452,575	R179H	probably damaging	Het
Myt1l	A	G	12: 29,910,789	T75A	probably benign	Het
Olfr1094	A	T	2: 86,828,854	D34V	probably benign	Het
Olfr1100	A	T	2: 86,978,461	C112S	possibly damaging	Het
Parp4	C	T	14: 56,613,724	T728M	probably damaging	Het
Ppp1r10	A	G	17: 35,928,492	T398A	possibly damaging	Het
Ppp4c	A	T	7: 126,792,100	I20N	probably damaging	Het
Rph3a	C	T	5: 120,947,927	G482D	probably damaging	Het
Rtel1	T	A	2: 181,349,972	F388I	probably benign	Het
Slc2a4	G	A	11: 69,946,116	S134F	probably damaging	Het
Tead4	A	T	6: 128,248,099		probably null	Het
Usp40	G	A	1: 87,949,979	Q1152*	probably null	Het

Other mutations in Slc12a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01488:Slc12a6	APN	2	112353064	splice site	probably null
IGL02573:Slc12a6	APN	2	112358641	critical splice donor site	probably null
petrified_forest	UTSW	2	112347426	missense	probably damaging	1.00
R0548:Slc12a6	UTSW	2	112335924	critical splice donor site	probably null
R1495:Slc12a6	UTSW	2	112354190	missense	probably damaging	0.99
R1726:Slc12a6	UTSW	2	112347426	missense	probably damaging	1.00
R1856:Slc12a6	UTSW	2	112335927	splice site	probably null
R1958:Slc12a6	UTSW	2	112355158	missense	possibly damaging	0.92
R2112:Slc12a6	UTSW	2	112356485	missense	probably damaging	1.00
R3888:Slc12a6	UTSW	2	112267030	missense	possibly damaging	0.76
R4412:Slc12a6	UTSW	2	112335888	missense	possibly damaging	0.95
R4655:Slc12a6	UTSW	2	112357766	critical splice acceptor site	probably null
R4669:Slc12a6	UTSW	2	112354295	missense	probably damaging	1.00
R4928:Slc12a6	UTSW	2	112352961	missense	probably damaging	1.00
R4974:Slc12a6	UTSW	2	112358525	missense	probably damaging	1.00
R5016:Slc12a6	UTSW	2	112356627	intron	probably benign
R5372:Slc12a6	UTSW	2	112347360	nonsense	probably null
R5405:Slc12a6	UTSW	2	112339379	missense	probably damaging	1.00
R5786:Slc12a6	UTSW	2	112284722	missense	probably benign	0.01
R5836:Slc12a6	UTSW	2	112341998	missense	possibly damaging	0.62
R6280:Slc12a6	UTSW	2	112337358	missense	probably damaging	1.00
R6310:Slc12a6	UTSW	2	112335839	missense	probably damaging	1.00
R6525:Slc12a6	UTSW	2	112352451	missense	probably damaging	1.00
R6597:Slc12a6	UTSW	2	112352935	missense	probably damaging	1.00
R6723:Slc12a6	UTSW	2	112337942	missense	probably damaging	1.00
R6895:Slc12a6	UTSW	2	112355095	missense	probably damaging	1.00
R7059:Slc12a6	UTSW	2	112352912	missense	probably damaging	0.99
R7188:Slc12a6	UTSW	2	112334415	missense	probably benign	0.04
R7395:Slc12a6	UTSW	2	112352542	missense	probably damaging	1.00
R7552:Slc12a6	UTSW	2	112341974	missense	probably damaging	1.00
R7992:Slc12a6	UTSW	2	112335911	missense	probably damaging	1.00
R8016:Slc12a6	UTSW	2	112356554	missense	probably benign	0.42
R8122:Slc12a6	UTSW	2	112266822	start codon destroyed	probably null
R8192:Slc12a6	UTSW	2	112351377	missense	probably damaging	1.00
R8222:Slc12a6	UTSW	2	112339525	splice site	probably null
R8534:Slc12a6	UTSW	2	112343967	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATACCTTTCCTTAGGGTGAGTG -3'
(R):5'- AAGCCTATGTTTGGTTACCTCTG -3'

Sequencing Primer
(F):5'- ACCTTTTTCAGCTTTAGAATTGGGAG -3'
(R):5'- TGCCATCATCACTATTTTTAGATGAC -3'

Posted On

2014-12-04