Incidental Mutation 'R2865:Rph3a'
ID253150
Institutional Source Beutler Lab
Gene Symbol Rph3a
Ensembl Gene ENSMUSG00000029608
Gene Namerabphilin 3A
Synonyms2900002P20Rik, Doc2 family
MMRRC Submission 040454-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2865 (G1)
Quality Score162
Status Validated
Chromosome5
Chromosomal Location120940499-121010092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120947927 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 482 (G482D)
Ref Sequence ENSEMBL: ENSMUSP00000143917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079204] [ENSMUST00000202326] [ENSMUST00000202406]
Predicted Effect probably damaging
Transcript: ENSMUST00000079204
AA Change: G482D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078198
Gene: ENSMUSG00000029608
AA Change: G482D

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202326
AA Change: G482D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144291
Gene: ENSMUSG00000029608
AA Change: G482D

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202406
AA Change: G482D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143917
Gene: ENSMUSG00000029608
AA Change: G482D

DomainStartEndE-ValueType
Pfam:FYVE_2 44 158 1e-38 PFAM
low complexity region 271 300 N/A INTRINSIC
low complexity region 347 377 N/A INTRINSIC
C2 395 500 2.93e-22 SMART
C2 553 667 1.85e-19 SMART
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an effector for RAB3A, which is a small G protein that acts in the late stages of neurotransmitter exocytosis. The encoded protein may be involved in neurotransmitter release and synaptic vesicle traffic. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous mutants are viable and fertile and do not exhibit any obvious abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,635 Q30R unknown Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm5065 G T 7: 5,359,669 D100Y probably benign Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Ldb3 T G 14: 34,529,503 D609A probably damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
March4 C T 1: 72,452,575 R179H probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp1r10 A G 17: 35,928,492 T398A possibly damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in Rph3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Rph3a APN 5 120948833 missense probably damaging 1.00
IGL02383:Rph3a APN 5 120963939 missense probably damaging 1.00
IGL02394:Rph3a APN 5 120946348 splice site probably null
IGL02429:Rph3a APN 5 120980124 splice site probably null
IGL02825:Rph3a APN 5 120945446 missense possibly damaging 0.94
R0282:Rph3a UTSW 5 120963910 nonsense probably null
R0325:Rph3a UTSW 5 120943064 missense probably benign 0.22
R0402:Rph3a UTSW 5 120942254 missense probably damaging 0.99
R0648:Rph3a UTSW 5 120959270 missense possibly damaging 0.77
R1807:Rph3a UTSW 5 120945393 missense probably damaging 0.99
R2273:Rph3a UTSW 5 120973304 missense probably damaging 0.98
R2519:Rph3a UTSW 5 120954422 missense probably damaging 1.00
R2939:Rph3a UTSW 5 120980149 splice site probably benign
R3153:Rph3a UTSW 5 120973377 missense probably damaging 1.00
R4289:Rph3a UTSW 5 120973305 missense probably damaging 1.00
R4775:Rph3a UTSW 5 120954488 missense probably benign 0.00
R4949:Rph3a UTSW 5 120963834 missense probably damaging 1.00
R4997:Rph3a UTSW 5 120963843 missense probably damaging 0.96
R5008:Rph3a UTSW 5 120945391 missense probably damaging 1.00
R5027:Rph3a UTSW 5 120954449 missense possibly damaging 0.90
R5155:Rph3a UTSW 5 120948770 missense possibly damaging 0.94
R5497:Rph3a UTSW 5 120942190 missense probably benign 0.28
R5931:Rph3a UTSW 5 120963873 missense probably damaging 0.99
R6273:Rph3a UTSW 5 120945422 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTTAGTCACTGTCCTGACCAGC -3'
(R):5'- CAGGCTGTGAACTGAGTCAC -3'

Sequencing Primer
(F):5'- TGACCAGCTGGACTCAGTGAG -3'
(R):5'- AGGCTGTGAACTGAGTCACTTACC -3'
Posted On2014-12-04