Incidental Mutation 'R2865:Gm5065'
ID253158
Institutional Source Beutler Lab
Gene Symbol Gm5065
Ensembl Gene ENSMUSG00000048398
Gene Namepredicted gene 5065
Synonyms
MMRRC Submission 040454-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R2865 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5350537-5360682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5359669 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 100 (D100Y)
Ref Sequence ENSEMBL: ENSMUSP00000146867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056639] [ENSMUST00000207531]
Predicted Effect probably benign
Transcript: ENSMUST00000056639
AA Change: D100Y

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055799
Gene: ENSMUSG00000048398
AA Change: D100Y

DomainStartEndE-ValueType
GLECT 31 165 1.56e-15 SMART
Gal-bind_lectin 37 165 2.51e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207531
AA Change: D100Y

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,635 Q30R unknown Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Ldb3 T G 14: 34,529,503 D609A probably damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
March4 C T 1: 72,452,575 R179H probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp1r10 A G 17: 35,928,492 T398A possibly damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rph3a C T 5: 120,947,927 G482D probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in Gm5065
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02060:Gm5065 APN 7 5359564 missense probably damaging 0.99
IGL02147:Gm5065 APN 7 5359733 missense probably damaging 1.00
R0771:Gm5065 UTSW 7 5359823 missense probably damaging 1.00
R0906:Gm5065 UTSW 7 5359829 missense probably damaging 0.99
R2018:Gm5065 UTSW 7 5359574 missense probably benign 0.18
R2258:Gm5065 UTSW 7 5359402 missense probably benign
R2519:Gm5065 UTSW 7 5359834 missense probably damaging 1.00
R5893:Gm5065 UTSW 7 5359624 missense probably benign 0.00
R7485:Gm5065 UTSW 7 5359441 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAGTTCAAGCTGGCGTGTAC -3'
(R):5'- AGGTCCCCACTGATCTTTATGGAG -3'

Sequencing Primer
(F):5'- CTTCCGTGGGCACATTAAAG -3'
(R):5'- CCCACTGATCTTTATGGAGTCAATTG -3'
Posted On2014-12-04