Incidental Mutation 'R2865:A230072I06Rik'
ID253162
Institutional Source Beutler Lab
Gene Symbol A230072I06Rik
Ensembl Gene ENSMUSG00000074473
Gene NameRIKEN cDNA A230072I06 gene
Synonyms
MMRRC Submission 040454-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2865 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location12278819-12280657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12279635 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 30 (Q30R)
Ref Sequence ENSEMBL: ENSMUSP00000096536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098935]
Predicted Effect unknown
Transcript: ENSMUST00000098935
AA Change: Q30R
SMART Domains Protein: ENSMUSP00000096536
Gene: ENSMUSG00000074473
AA Change: Q30R

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189500
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm5065 G T 7: 5,359,669 D100Y probably benign Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Ldb3 T G 14: 34,529,503 D609A probably damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
March4 C T 1: 72,452,575 R179H probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp1r10 A G 17: 35,928,492 T398A possibly damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rph3a C T 5: 120,947,927 G482D probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in A230072I06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:A230072I06Rik UTSW 8 12279899 missense unknown
R0149:A230072I06Rik UTSW 8 12280000 missense unknown
R5809:A230072I06Rik UTSW 8 12279556 missense unknown
R7503:A230072I06Rik UTSW 8 12279554 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGTCTAGTATGGCTGTCCTC -3'
(R):5'- CTGTGGTGTACTAGCTAGGC -3'

Sequencing Primer
(F):5'- CTCTCCTGGTGCAATGAGTGAAG -3'
(R):5'- GGTGTACTAGCTAGGCTCTTTCCAC -3'
Posted On2014-12-04