Incidental Mutation 'R2865:Fnip1'
ID253172
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
MMRRC Submission 040454-MU
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock #R2865 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54502424 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 562 (I562T)
Ref Sequence ENSEMBL: ENSMUSP00000049026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]
Predicted Effect probably damaging
Transcript: ENSMUST00000046835
AA Change: I562T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: I562T

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143650
AA Change: I538T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992
AA Change: I538T

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Meta Mutation Damage Score 0.1675 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,635 Q30R unknown Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm5065 G T 7: 5,359,669 D100Y probably benign Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Ldb3 T G 14: 34,529,503 D609A probably damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
March4 C T 1: 72,452,575 R179H probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp1r10 A G 17: 35,928,492 T398A possibly damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rph3a C T 5: 120,947,927 G482D probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54515499 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGGAGGTTTCTCATGATTGAAAGAC -3'
(R):5'- CTGTATTTTGCCCAAGGACTGG -3'

Sequencing Primer
(F):5'- CATGATTGAAAGACTGTTTAGCTGTG -3'
(R):5'- GGACTGGATGACTGCAATATTTACAG -3'
Posted On2014-12-04