Incidental Mutation 'R2472:Olfr1394'
ID253173
Institutional Source Beutler Lab
Gene Symbol Olfr1394
Ensembl Gene ENSMUSG00000048378
Gene Nameolfactory receptor 1394
SynonymsMOR280-1, GA_x6K02T2QP88-6274566-6273628
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2472 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49154377-49162854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49160371 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 119 (V119A)
Ref Sequence ENSEMBL: ENSMUSP00000149520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052668] [ENSMUST00000216273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052668
AA Change: V119A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063062
Gene: ENSMUSG00000048378
AA Change: V119A

DomainStartEndE-ValueType
Pfam:7tm_4 30 309 6.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 37 233 3e-5 PFAM
Pfam:7tm_1 43 292 2.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216273
AA Change: V119A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,506,252 S291P probably damaging Het
Cbln3 T C 14: 55,884,081 E36G possibly damaging Het
Cdcp1 A G 9: 123,185,107 F201L probably benign Het
Crispld1 A T 1: 17,745,828 R142S probably null Het
Dsc2 T A 18: 20,045,469 M293L probably benign Het
Dzip3 A T 16: 48,953,787 S362T possibly damaging Het
Grm4 C T 17: 27,434,675 C512Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L1td1 C T 4: 98,733,159 probably benign Het
Nav2 A G 7: 49,408,884 T252A probably benign Het
Neu3 A C 7: 99,813,407 S370A probably damaging Het
Nfasc T A 1: 132,588,221 probably benign Het
Ptk7 T C 17: 46,576,848 T553A probably benign Het
Rap2a T C 14: 120,478,833 I36T possibly damaging Het
Rinl A C 7: 28,790,378 D7A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16a T C 2: 26,439,936 E689G probably damaging Het
Sec31a T C 5: 100,385,205 I560M probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Setdb2 G A 14: 59,419,454 T138I possibly damaging Het
Sgsh G T 11: 119,355,474 P4Q possibly damaging Het
Slco4a1 G T 2: 180,467,087 W308L probably damaging Het
Ttn T A 2: 76,781,519 R17346S possibly damaging Het
Ubxn4 A G 1: 128,272,869 R366G probably damaging Het
Vmn2r90 T G 17: 17,728,146 N551K probably damaging Het
Other mutations in Olfr1394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr1394 APN 11 49160674 missense probably damaging 1.00
IGL01603:Olfr1394 APN 11 49160611 missense probably damaging 1.00
IGL01736:Olfr1394 APN 11 49160527 missense probably damaging 1.00
IGL02246:Olfr1394 APN 11 49160094 missense probably benign 0.44
IGL02321:Olfr1394 APN 11 49160775 missense probably damaging 1.00
IGL03405:Olfr1394 APN 11 49160886 unclassified probably null
R0358:Olfr1394 UTSW 11 49160244 missense probably benign 0.00
R1967:Olfr1394 UTSW 11 49160848 missense probably benign 0.06
R3824:Olfr1394 UTSW 11 49160793 missense possibly damaging 0.48
R4105:Olfr1394 UTSW 11 49160548 missense possibly damaging 0.51
R4255:Olfr1394 UTSW 11 49160435 nonsense probably null
R4716:Olfr1394 UTSW 11 49160890 missense probably damaging 1.00
R5545:Olfr1394 UTSW 11 49160626 missense probably damaging 1.00
R6894:Olfr1394 UTSW 11 49160359 missense probably benign 0.06
R6999:Olfr1394 UTSW 11 49160412 missense possibly damaging 0.53
Z1177:Olfr1394 UTSW 11 49160298 missense possibly damaging 0.82
Z1177:Olfr1394 UTSW 11 49160865 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGTAACATCCTCCTCTTGATGG -3'
(R):5'- TGGTCCACCTCTAGAGATCC -3'

Sequencing Primer
(F):5'- TGGATAGACGCCTGCACAC -3'
(R):5'- ACCTCTAGAGATCCACAATAGGG -3'
Posted On2014-12-04