Incidental Mutation 'R2865:Ldb3'
ID253182
Institutional Source Beutler Lab
Gene Symbol Ldb3
Ensembl Gene ENSMUSG00000021798
Gene NameLIM domain binding 3
Synonymscypher, ZASP
MMRRC Submission 040454-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2865 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34526603-34588682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34529503 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 609 (D609A)
Ref Sequence ENSEMBL: ENSMUSP00000154758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022327] [ENSMUST00000022328] [ENSMUST00000064098] [ENSMUST00000090040] [ENSMUST00000228044]
Predicted Effect probably damaging
Transcript: ENSMUST00000022327
AA Change: D710A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798
AA Change: D710A

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022328
AA Change: D648A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798
AA Change: D648A

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064098
AA Change: D666A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798
AA Change: D666A

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090040
AA Change: D671A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798
AA Change: D671A

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228044
AA Change: D609A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in lethality within a few days after birth from muscle abnormalities. Mutant mice exhibit myopathy, dysphagia, heart vascular congestion, dilated heart ventricles, cyanosis, and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,635 Q30R unknown Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm5065 G T 7: 5,359,669 D100Y probably benign Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
March4 C T 1: 72,452,575 R179H probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp1r10 A G 17: 35,928,492 T398A possibly damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rph3a C T 5: 120,947,927 G482D probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in Ldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ldb3 APN 14 34544200 missense probably damaging 0.99
IGL01485:Ldb3 APN 14 34542562 missense probably damaging 1.00
IGL01983:Ldb3 APN 14 34577199 missense probably benign 0.00
R0323:Ldb3 UTSW 14 34544045 missense probably damaging 1.00
R0335:Ldb3 UTSW 14 34578651 missense possibly damaging 0.77
R0483:Ldb3 UTSW 14 34536584 missense probably damaging 1.00
R0920:Ldb3 UTSW 14 34567503 missense probably benign 0.05
R1524:Ldb3 UTSW 14 34555356 missense probably benign 0.01
R2161:Ldb3 UTSW 14 34567396 critical splice donor site probably null
R2246:Ldb3 UTSW 14 34529475 missense probably damaging 0.99
R3113:Ldb3 UTSW 14 34529461 makesense probably null
R3765:Ldb3 UTSW 14 34578682 splice site probably null
R3870:Ldb3 UTSW 14 34567483 missense probably damaging 1.00
R4018:Ldb3 UTSW 14 34552171 splice site probably benign
R4797:Ldb3 UTSW 14 34555513 missense possibly damaging 0.95
R4963:Ldb3 UTSW 14 34566858 missense probably damaging 0.98
R5705:Ldb3 UTSW 14 34577029 missense probably null 0.01
R6401:Ldb3 UTSW 14 34577334 missense probably benign 0.33
R6549:Ldb3 UTSW 14 34541897 missense probably damaging 0.99
R6682:Ldb3 UTSW 14 34552264 missense possibly damaging 0.77
R6917:Ldb3 UTSW 14 34555364 missense probably null 0.03
R7132:Ldb3 UTSW 14 34577035 missense probably benign 0.25
R7327:Ldb3 UTSW 14 34571802 missense probably damaging 1.00
R7488:Ldb3 UTSW 14 34567445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGGATTAATTACTAGCTGGG -3'
(R):5'- AACCTACACAGTTGGTCCAG -3'

Sequencing Primer
(F):5'- CTAAAGTTAGACTTCAAAAGGGCTC -3'
(R):5'- CACAGTTGGTCCAGTCATTAGAC -3'
Posted On2014-12-04