Mutagenetix > Incidental Mutation

Incidental Mutation 'R2865:Igf2r'

253188

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR

MMRRC Submission

040454-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.905) question?

Stock #

R2865 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12901293-12988551 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12905611 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 2240 (H2240R)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably damaging
Transcript: ENSMUST00000024599
AA Change: H2240R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: H2240R

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.2092

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	A	G	8: 12,329,635 (GRCm39)	Q30R	unknown	Het
Bmper	A	G	9: 23,395,237 (GRCm39)	N656S	probably benign	Het
Cic	T	A	7: 24,972,646 (GRCm39)	D792E	probably damaging	Het
Dab1	G	A	4: 104,537,343 (GRCm39)	C192Y	probably benign	Het
Ddx6	G	T	9: 44,525,553 (GRCm39)	L103F	probably damaging	Het
Fhod1	T	C	8: 106,059,543 (GRCm39)	K714R	probably null	Het
Flt1	T	C	5: 147,531,431 (GRCm39)	Q844R	possibly damaging	Het
Fnip1	T	C	11: 54,393,250 (GRCm39)	I562T	probably damaging	Het
Fxr2	T	A	11: 69,530,253 (GRCm39)	I40N	probably damaging	Het
Gm7168	A	G	17: 14,170,117 (GRCm39)	K495E	probably benign	Het
Gria2	C	T	3: 80,639,392 (GRCm39)	V207I	probably benign	Het
Ifna6	G	C	4: 88,746,099 (GRCm39)	R149S	probably benign	Het
Ifna6	C	A	4: 88,746,086 (GRCm39)	T145K	probably benign	Het
Ighv8-9	G	A	12: 115,432,066 (GRCm39)	P82S	probably benign	Het
Itpr3	T	C	17: 27,310,525 (GRCm39)	V436A	probably benign	Het
Ldb3	T	G	14: 34,251,460 (GRCm39)	D609A	probably damaging	Het
Lgalsl2	G	T	7: 5,362,668 (GRCm39)	D100Y	probably benign	Het
Luc7l	C	A	17: 26,485,335 (GRCm39)	Q112K	probably damaging	Het
Marchf4	C	T	1: 72,491,734 (GRCm39)	R179H	probably damaging	Het
Myt1l	A	G	12: 29,960,788 (GRCm39)	T75A	probably benign	Het
Or5t9	A	T	2: 86,659,198 (GRCm39)	D34V	probably benign	Het
Or8h10	A	T	2: 86,808,805 (GRCm39)	C112S	possibly damaging	Het
Parp4	C	T	14: 56,851,181 (GRCm39)	T728M	probably damaging	Het
Ppp1r10	A	G	17: 36,239,384 (GRCm39)	T398A	possibly damaging	Het
Ppp4c	A	T	7: 126,391,272 (GRCm39)	I20N	probably damaging	Het
Rph3a	C	T	5: 121,085,990 (GRCm39)	G482D	probably damaging	Het
Rtel1	T	A	2: 180,991,765 (GRCm39)	F388I	probably benign	Het
Slc12a6	G	A	2: 112,177,662 (GRCm39)	V594I	probably benign	Het
Slc2a4	G	A	11: 69,836,942 (GRCm39)	S134F	probably damaging	Het
Tead4	A	T	6: 128,225,062 (GRCm39)		probably null	Het
Usp40	G	A	1: 87,877,701 (GRCm39)	Q1152*	probably null	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,932,877 (GRCm39)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,958,215 (GRCm39)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,919,245 (GRCm39)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,902,754 (GRCm39)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,923,662 (GRCm39)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,914,261 (GRCm39)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,923,236 (GRCm39)	missense	probably benign
IGL01557:Igf2r	APN	17	12,923,522 (GRCm39)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,902,872 (GRCm39)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,944,302 (GRCm39)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,920,200 (GRCm39)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,902,709 (GRCm39)	missense	probably benign
IGL01839:Igf2r	APN	17	12,923,909 (GRCm39)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,933,798 (GRCm39)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,923,225 (GRCm39)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,912,079 (GRCm39)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,920,892 (GRCm39)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,917,403 (GRCm39)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,967,650 (GRCm39)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,930,974 (GRCm39)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,938,770 (GRCm39)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,911,610 (GRCm39)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,913,007 (GRCm39)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,929,633 (GRCm39)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,945,563 (GRCm39)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,935,559 (GRCm39)	missense	probably damaging	1.00
blunt	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
brusque	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
gruff	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
outlier	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,910,849 (GRCm39)	missense	probably benign
R0165:Igf2r	UTSW	17	12,917,414 (GRCm39)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,902,835 (GRCm39)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,910,951 (GRCm39)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,936,161 (GRCm39)	splice site	probably null
R0722:Igf2r	UTSW	17	12,934,382 (GRCm39)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,910,988 (GRCm39)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,913,011 (GRCm39)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,936,156 (GRCm39)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,910,172 (GRCm39)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,945,196 (GRCm39)	missense	probably benign
R1693:Igf2r	UTSW	17	12,923,203 (GRCm39)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,916,328 (GRCm39)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,923,157 (GRCm39)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,952,790 (GRCm39)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,911,625 (GRCm39)	missense	probably benign
R2060:Igf2r	UTSW	17	12,920,206 (GRCm39)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,917,138 (GRCm39)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,941,095 (GRCm39)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,934,830 (GRCm39)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,941,198 (GRCm39)	splice site	probably null
R2696:Igf2r	UTSW	17	12,914,231 (GRCm39)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,928,355 (GRCm39)	missense	probably benign
R3930:Igf2r	UTSW	17	12,924,716 (GRCm39)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,967,638 (GRCm39)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,921,141 (GRCm39)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,922,352 (GRCm39)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,903,013 (GRCm39)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,920,240 (GRCm39)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,910,764 (GRCm39)	splice site	probably null
R4980:Igf2r	UTSW	17	12,922,247 (GRCm39)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,944,303 (GRCm39)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,912,032 (GRCm39)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,958,221 (GRCm39)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,936,254 (GRCm39)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,917,239 (GRCm39)	splice site	probably null
R5794:Igf2r	UTSW	17	12,928,332 (GRCm39)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,933,000 (GRCm39)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,902,787 (GRCm39)	missense	probably benign
R6396:Igf2r	UTSW	17	12,932,977 (GRCm39)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,920,137 (GRCm39)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,917,505 (GRCm39)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,933,831 (GRCm39)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,932,969 (GRCm39)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,922,263 (GRCm39)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,916,228 (GRCm39)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,937,605 (GRCm39)	missense	probably benign
R7030:Igf2r	UTSW	17	12,952,753 (GRCm39)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,917,212 (GRCm39)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,923,210 (GRCm39)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,933,003 (GRCm39)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,922,371 (GRCm39)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,917,115 (GRCm39)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,929,532 (GRCm39)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,917,160 (GRCm39)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,954,878 (GRCm39)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,958,256 (GRCm39)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,967,591 (GRCm39)	missense	probably benign
R8022:Igf2r	UTSW	17	12,937,682 (GRCm39)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,920,125 (GRCm39)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,910,958 (GRCm39)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,952,747 (GRCm39)	missense	probably benign
R8359:Igf2r	UTSW	17	12,902,748 (GRCm39)	missense	probably benign
R8500:Igf2r	UTSW	17	12,928,328 (GRCm39)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,923,200 (GRCm39)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,923,524 (GRCm39)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,920,131 (GRCm39)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,945,659 (GRCm39)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,935,537 (GRCm39)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,970,180 (GRCm39)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,910,100 (GRCm39)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,958,238 (GRCm39)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,914,240 (GRCm39)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,924,646 (GRCm39)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,917,215 (GRCm39)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,905,641 (GRCm39)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,913,027 (GRCm39)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,945,588 (GRCm39)	missense	probably benign
X0028:Igf2r	UTSW	17	12,923,800 (GRCm39)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,916,286 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAGCCAATCTTGTGGGCAC -3'
(R):5'- CGGGTTTGCACCTTTAACATTAAG -3'

Sequencing Primer
(F):5'- CCCCAGTGTTCTACCTAGGAGAC -3'
(R):5'- AACATTAAGCCTGTGCCAGCTTTG -3'

Posted On

2014-12-04